BME103:T930 Group 10 l2: Difference between revisions
(6 intermediate revisions by one other user not shown) | |||
Line 12: | Line 12: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- | |- valign="top" | ||
| [[Image:BME103student.jpg|100px|thumb|Name: Nolan Bidese<br>Role: Research and Development]] | | [[Image:BME103student.jpg|100px|thumb|Name: Nolan Bidese<br>Role: Research and Development]] | ||
| [[Image:BME103student.jpg|100px|thumb|Name: Evan Austin<br>Role: Open PCR Thermal Cycler Engineer]] | | [[Image:BME103student.jpg|100px|thumb|Name: Evan Austin<br>Role: Open PCR Thermal Cycler Engineer]] | ||
Line 208: | Line 208: | ||
5'ACAAAGGAAAAAGTTCT'''ATT'''TC3' | 5'ACAAAGGAAAAAGTTCT'''ATT'''TC3' | ||
ATG ⇒ ATT The change in | ATG ⇒ ATT The change in mutated protein | ||
Reverse Primer: TGTTTCCTTTTTCAAGATAAAG | Reverse Primer: TGTTTCCTTTTTCAAGATAAAG | ||
5'CAACTTACACTGGACGTCCAGA3' | |||
CGC ⇒ CTC change in the mutated protein | |||
Reverse Primer: GTTGAATGTGACCTGCAGGTCT | |||
'''Illustration''' | '''Illustration''' | ||
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | ||
[[Image:SNP.jpg]] | |||
[http://www.sciencedirect.com/science/article/pii/S0167701206002247] | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} |
Latest revision as of 18:45, 29 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
2. There will be no latch 3. Screw in four magnets on machine top and lid at corners. 4. This will secure lid down to machine. 5. Follow instructions to adding side panels to lid with exceptions. 6. Exception: Replace two opposite sides on lid with plexi-glass
2. Exception 1: Lid can now come off entirely due to magnetic screws. 3. Will make it easier to adding vial tubes. 4. Exception 2: Use plexi-glass to see how much to screw down the heating pad. 5. Will ensure proper fit of heating lid.
ProtocolsMaterials For PCR Protocol
1. Label Eppendorf Tubes with 1-17. Each tube should contain 50 microliters of one of the following substances:
2. Use properly labeled micropipette to place 17 samples into 17 properly labeled Eppendorf tubes already containing 50 microliters GoTaq mix. To see contents of GoTaq mix, see materials. DNA Measurement Protocol 1. With permanent marker, clearly number micropipettes. With permanent marker, number Eppendorf tubes at the top. There should be 17 labeled micropipettes and 17 Eppendorf tubes. Research and DevelopmentBackground on Disease Markers The prostate is a gland in the male reproductive system located just below the bladder. It is about the size of a walnut and surrounds part of the urethra. The prostate gland helps to control urinary and sexual functions that are associated with the reproductive system.[1] Risk Factors for prostate cancer are age, race, and family genetics of prostate cancer. The marker being used is rs137852593 [2] This SNP is associated with a defect in a protein in the prostate that may or may not cause cancer in the prostate. It is located on the X chromosome and the mutated protein goes from R [Arg] ⇒ L [Leu]. Leukemia is a type of cancer that affects the blood and bone marrow. The disease develops when blood cells produced in the bone marrow grow out of control. An estimated 44,600 new cases of leukemia are expected to be diagnosed in the United States in 2011. [3] The marker being used for this is rs111033629.[4] The SNP is associated with a defect in a protein in bone marrow. It is located on the X chromosome and the mutated protein goes from M [Met] ⇒ I [Ile].
5'ACAAAGGAAAAAGTTCTATTTC3' ATG ⇒ ATT The change in mutated protein Reverse Primer: TGTTTCCTTTTTCAAGATAAAG 5'CAACTTACACTGGACGTCCAGA3' CGC ⇒ CTC change in the mutated protein Reverse Primer: GTTGAATGTGACCTGCAGGTCT Illustration |