BME103:T930 Group 1: Difference between revisions
Line 13: | Line 13: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- valign="top" | |- valign="top" | ||
| [[Image:BME103student.jpg|100px|thumb|Joseph Heath:<br>Research & Development Scientist]] | | [[Image:BME103student.jpg|100px|thumb|Joseph Heath:<br>Research & Development Scientist & PCR Machine Engineer]] | ||
| [[Image:BME103student.jpg|100px|thumb|Jessica Kemper:<br>Experimental Protocol Planner]] | | [[Image:BME103student.jpg|100px|thumb|Jessica Kemper:<br>Experimental Protocol Planner]] | ||
| [[Image:BME103student.jpg|100px|thumb|Maile Ravenkamp:<br>Experimental Protocol Planner]] | | [[Image:BME103student.jpg|100px|thumb|Maile Ravenkamp:<br>Experimental Protocol Planner]] | ||
| [[Image:BME103student.jpg|100px|thumb|Nick Hool:<br>PCR Machine Engineer]] | | [[Image:BME103student.jpg|100px|thumb|Nick Hool:<br>PCR Machine Engineer]] | ||
| [[Image:BME103student.jpg|100px|thumb|Christian Boden:<br>PCR Machine Engineer]] | | [[Image:BME103student.jpg|100px|thumb|Christian Boden:<br>PCR Machine Engineer & Research & Development Scientist]] | ||
|} | |} | ||
Revision as of 12:01, 1 November 2012
BME 103 Fall 2012 | Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||
OUR TEAMLAB 1 WRITE-UP(Please finish by 11/7/2012) Initial Machine TestingThe Original Design
When we unplugged the mounting plate from the open PCR circuit board, the display screen on the PCR box did not work. When we unplugged the white wire that connects the open PCR circuit board to the heating block, there was no temperature reading on the display screen.
(First Open PCR test: 10/25/12. We had a successful and simple run of PCR)
ProtocolsPolymerase Chain Reaction
Flourimeter Measurements (Add your work from Week 3, Part 2 here)
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology The r17879961 cancer-associated sequence (AAACTCTTACACTGCATACA) will produce a DNA signal because of its nucleotide variation (ACATTGC to ACACTGC). This T-C change results in an isoleucene to threonine substitution. In a study in Finland, patients with colorectal cancer (CRC), the most common cancer associated with the DNA sequence change, had the allele 7.8% of the time while patients without CRC had the allele in 5.3% of patients, showing a significantly higher association in CRC patients.[1] PCR detection will only give a signal if this allele is present.
Results(Your group will add the results of your Fluorimeter measurements from Week 4 here)
|