A Polymerase Chain Reaction (PCR) Machine (shown in the above image) is used to create large quantities of specific DNA sequences. This process consists of various heating and cooling cycles to unzip DNA strands and isolate the wanted DNA strands.
Experimenting With the Connections
When the Liquid Crystal Display (LCD) screen is disconnected from the open PCR circuit board, the LCD screen is shut off. The circuit board provides the power and input signals for the LCD screen, therefore, when the two parts are not connected the LCD screen will not function. When the 16-tube PCR block is disconnected from the PCR circuit board the block will not heat or cool. The fan and lid heater are both connected to the PCR circuit board with wires, so if this connection is disrupted, those parts will not function.
Test Run
The initial test was ran on October 25, 2012 on machine number 9. The machine worked well, all cycles were conducted and there were no problems with its completion.
Protocols
Polymerase Chain Reaction
1.) The DNA samples were heated to ninety-five degrees Celsius (95°C) for three (3) minutes to unzip the two single strands.
2.) They were then cooled to fifty-seven degrees Celsius (57°C) and the primers were attached to their matching sequences.
3.) They were then heated back to seventy-two degrees Celsius (72°C) and polymerase extended the DNA strands by attaching the correct free nucleotides in order on the single strands.
GoTaq Mix Components For 100μl reaction volume:
2X GoTaq Colorless Master Mix
10 μM upstream primer
10 μM downstream primer
DNA template
Nuclease-Free Water to
Reagent
Volume
Template DNA (20 ng)
0.1μL
10μM forward primer
0.5μL
10μM reverse primer
0.5μL
GoTaq master mix
25.0μL
dH2O
23.9μL
Total Volume
50.0μL
Patient 1
ID 30269
Male, 55 years old
Patient 2
ID 22057
Female, 55 years old
Fluorimeter Measurements
Fluorimeter Assembly Procedure
1.) Label transfer pipettes and tubes
2.) Transfer each sample separately into tube containing 400μl of buffer
3.) Take the specifically labeled tube containing SYBR GREEN 1 and place 2 drops on the first 2 centered drops
4.) Place 2 drops of diluted sample on top of the SYBR GREEN 1 drop
5.) Align light through drop
6.) Take pictures using light box
7.) Repeat for each sample.
8.) Run water as BLANK using same procedure
Image J Instructions
1.) Open ImageJ
2.) Click ANALYZE tool bar and select SET MEASUREMENTS
3.) Select AREA, MEAN GREY VALUE, and INTEGRATED DENSITY
4.) Upload image to ImageJ
5.) Select IMAGE then COLOR and then SPLIT CHANNELS
6.) Only use green channel
7.) Use OVAL tool and select the entire drop of liquid
8.) Go to ANALYZE and then MEASURE
9.) Drag circle to the background of the image
10.) Record results
11.) Repeat if necessary
Research and Development
The Underlying Technology
Polymerase Chain Reaction, also known as PCR, is used to reproduce or amplify specific sections of DNA. A PCR machine carries out this reaction synthetically.
Components of a PCR reaction: Template DNA: This is the initial strand of DNA used to amplify in the PCR machine. DNA can contain a certain sequence located on a gene that has been linked with having the disease of cancer. Only one copy of this sequence of nucleotides is located in the cell out off around 6 billion individual nucleotides. The purpose of PCR is to locate this strand using a primer and then amplify the sequence.
Primer: A reagent that is artificially synthesized DNA sequence that binds specifically to the target sequence of the template DNA, in this case the sequence that is linked with cancer. If the target sequence is not present on the template DNA, then the primer will not bind and amplification will not occur.
Taq Polymerase: This is an enzyme that drives DNA replication. Polymerase builds each single strand of DNA marked by a primer into a new, double-stranded DNA segment. It works by finding the ends of the primers, finding free nucleotides from an added solution, then it scans the template DNA to match the proper nucleotides and attaches these nucleotides with hydrogen bonds. The benefit of using Taq Polymerse is that it can withstand extreme temperatures and does not denature during the process of the PCR reaction.
Magnesium Chloride: This compound is added to the reaction mixture and binds to the Taq Polymerase, it is used to help the reaction function smoothly and can be adjusted to control the speed of the reaction.
dNTP’s: This is the mixture of free bases needed to combine to make new DNA strands that are the product of this reaction.
During the thermal cycling three steps occur:
1.) The temperature is set to 95 °C which causes the DNA to unzip and the sequences are exposed to the primer.
2.) The temperature is set to 57 °C which causes the primer to attach at the desired sequence.
3.) The temperature is set to 72 °C which causes the polymerase to extend the DNA strand by attaching the correct free nucleotides in order on a single strand.
This process is repeated several times to produce huge quantities of the specific piece of DNA that is being examined. By having this enormous amount of DNA, we can accurately test whether or not the patient contains specific markers that indicate that cancer is present in the cells.
The single nucleotide polymorphism (SNP), 17879961, that is being examined in this experiment is known to be linked with breast and colorectal cancer. The SNP is located on the 22nd chromosome and affects the gene checkpoint kinase 2. The sequence of this gene is: GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCACAGTGGC
The error in this sequence is represented by [C/T] which means that the normal T base pair has been mutated into a C base pair resulting in an allele that expresses cancer.
The primers associated with this sequence of DNA:
Reverse primer: AACTCTTACACTGCATACAT
Forward primer: TTGAGAATGTGACGTATGTA
Why does a cancer gene produce a positive result and a non-cancer gene gives a negative result?
The cancer gene contains the marker matched with the primer. The non-cancer gene does not contain the marker so therefore the primer does not attach and replication does not occur.
Baye’s Rule is then used to allow understanding of the limitations of the tests.
Reliability (Baye's Rule) Explanation: Baye’s Rule analyzes all available data and allows us to understand the limitations of our diagnostic tests. It shows the relationship between conditional probability and its reverse form. Baye’s reasoning can be applied to find the probability of true positives in relation to false positives and false negatives. This allows us to understand how reliable PCR is in detecting cancer sequences in patients.
Conditional Probabilities
p(T|C)=80%
p(T|~C)=9.6% Proportion of cancer patients with positive results, within the group of ALL patients with positive results:
A/(A+C)
=80/(80+950)
=80/1030
=.078
=7.8%
Integrated Density = The integrated density (INTDEN) was calculated by subtracting the INTDEN of the drop from the INTDEN of the backround.
DNA μg/mL = The DNA concentration was calculated by diving the INTDEN of the selected sample by INTDEN of the positive control and the multiplying by the density of the positive control
Conclusion = Positive signal means the sample glowed green and cancer was present. No sample was a clear result and resulted in no cancer being present.