Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design
All wood structures will be replaced with a high density plastic material. The screws will be replaced with snap on hinges.
Key Features
Instructions
Protocols
Materials
Supplied in the Kit
Amount
PCR Machine
1X
Sybr Green Buffer
1μL (Can be diluted up to 10,000 times)
Regular Buffer (Magnesium Chloride)
1μL (Can be diluted up to 10,000 times)
4 bases
25μL
Primers
25μL
Micropipets
4X
ImageJ Installation Disc
1X
DNA Polymerase
5,000 units/mL
Supplied by User
Amount
DNA samples
1 pipet droplet
PCR Protocol
DNA Measurement Protocol
Research and Development
Background on Disease Markers
The disease marker being used is SNP (single nucleotide polymorphism) rs35685286. This is the marker for sickle-cell disease found on chromosome 11. Patients with sickle-cell disease have red blood cells that are mishapen and are a "sickled" or crescent shape. This results in less oxygen being carried to the patient's body tissues. Therefore, patients experience crisis, where they have severe pain in their bones in their backs or chest. These symptoms can last for hours or even days.
The forward primer for this disease is ACTCCGGACCCGTCCAACCAT and the reverse primer for a patient without sickle-cell disease would be TGAGGCCTGGGCAGGGTTGGTA. If a patient were to be positive for sickle-cell disease, their reverse primer would be TGAGGCCTGGACAGGTTGGTA. Therefore, a patient with this disease experiences the gene mutation from G binding to C to G binding to A. A positive test will be recognizable because while the DNA is replicating during the PCR process, the reverse primers will only attach to the diseased patient's DNA. Consequently, when the reaction is complete and the SYBR green is added, the diseased patient's DNA will appear to glow green. If a patient does not have the disease, their DNA will be present in single strands and will appear clear when injected with SYBR green.