Difference between revisions of "BME103:T130 Group 1 l2"

From OpenWetWare
Jump to: navigation, search
(Research and Development)
(7 intermediate revisions by 3 users not shown)
Line 35: Line 35:
'''Key Features'''<br>
'''Key Features'''<br>
The key features of change we are focusing on is the casing and how it is assembled/dissembled. Our design changes are to use high density plastic instead of the wood casing currently used. We would also change from using screws to using a snap on feature. These simple changes will create major improvements in the PCR system. Using high density plastic will make it easy to see inside and to know when the heating lid is in proper place. It was also secure the safety issues of the wood being flammable. Then change from using screws to a snap on feature will make it easy and quick to assemble and disassemble. Before when using screws, it was stressful with dropping screws within the PCR causing you to have to start over with the assembly. With a snap on feature, the casing will simply snap on and off making the assembly quick and easy with no need of tools like a screwdriver.
*Place the plastic base of the PCR on a flat surface
*Attach the back panel of the casing via interlocking hinges
*Attach both the left and right sides to the back panel as well as the base
*Snap the lid components onto the top of the PCR so that the there is only one face of the structure still open
*insert internal devices in their appropriate places
*Snap the front panel onto the 3 sides of the PCR to complete the external shell of the PCR
<!--- From Week 4 exercise --->
<!--- From Week 4 exercise --->
Line 106: Line 111:
<!--- Place your two tables "Supplied in the kit" and "Supplied by User" here --->
<!--- Place your two tables "Supplied in the kit" and "Supplied by User" here --->
[[image:Images.jpg |450px]]<br>
    Image credit goes to: http://www.elitechgroup.com/corporate/products/market-segment/molecular-diagnostics/real-time-pcr/elite-mgb-r-based-
'''PCR Protocol'''
'''PCR Protocol'''
*Place the PCR machine in a leveled surface and plug into an outlet.
*Collect a sample of DNA, such as blood sample.
*Add primers to the DNA sample along with the magnesium chloride buffer and the base.
*Place the mixed solution into the machine.
*turn the machine up to 95 degree Celsius to separate the double stranded DNA for 3 minutes.
*Then decrease the temperature to 57 degree Celsius for 30 seconds for the primers to bind to the separated DNA strand, forming the
new double stranded DNA.
*Then turn the temperature up to 72 degree Celsius for polymerization.
*Repeat the temperature adjustment cycle for 34-35 cycles.
'''DNA Measurement Protocol'''
'''DNA Measurement Protocol'''
*After you add SYBR Green to the duplicated DNA sample, place the resulting DNA strand into a fluorimeter.
*Shine light onto the sample and use a photo-taking device to record the picture of the glowing sample.
*Use imagej to calculate the INTDEN.
*Redo the process for a control group sample, in which the sample does not contain the DNA strand or segment that causes a certain
==Research and Development==
==Research and Development==

Latest revision as of 13:05, 28 November 2012

Owwnotebook icon.png BME 103 Fall 2012 Home
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Wiki Editing Help
BME494 Asu logo.png


Name: Tianzhu Zhu
Experimental protocol planner
Name: Wyatt Hansen
Open PCR machine engineer
Name: Bryce Hicok
Open PCR machine engineer
Name: Jesus Ibarra
Experimental protocol planner
Name: Emma Maiorella
R&D scientist


Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.

System Design

PCR redesign.png
All wood structures will be replaced with a high density plastic material. The screws will be replaced with snap on hinges.

Key Features
The key features of change we are focusing on is the casing and how it is assembled/dissembled. Our design changes are to use high density plastic instead of the wood casing currently used. We would also change from using screws to using a snap on feature. These simple changes will create major improvements in the PCR system. Using high density plastic will make it easy to see inside and to know when the heating lid is in proper place. It was also secure the safety issues of the wood being flammable. Then change from using screws to a snap on feature will make it easy and quick to assemble and disassemble. Before when using screws, it was stressful with dropping screws within the PCR causing you to have to start over with the assembly. With a snap on feature, the casing will simply snap on and off making the assembly quick and easy with no need of tools like a screwdriver.


  • Place the plastic base of the PCR on a flat surface
  • Attach the back panel of the casing via interlocking hinges
  • Attach both the left and right sides to the back panel as well as the base
  • Snap the lid components onto the top of the PCR so that the there is only one face of the structure still open
  • insert internal devices in their appropriate places
  • Snap the front panel onto the 3 sides of the PCR to complete the external shell of the PCR



Supplied in the Kit Amount
PCR Machine 1X
Sybr Green Buffer 1μL (Can be diluted up to 10,000 times)
Regular Buffer (Magnesium Chloride) 1μL (Can be diluted up to 10,000 times)
4 bases 25μL
Primers 25μL
Micropipets 4X
ImageJ Installation Disc 1X
DNA Polymerase 5,000 units/mL

Supplied by User Amount
DNA samples 1 pipet droplet


    Image credit goes to: http://www.elitechgroup.com/corporate/products/market-segment/molecular-diagnostics/real-time-pcr/elite-mgb-r-based-

PCR Protocol


  • Place the PCR machine in a leveled surface and plug into an outlet.
  • Collect a sample of DNA, such as blood sample.
  • Add primers to the DNA sample along with the magnesium chloride buffer and the base.
  • Place the mixed solution into the machine.
  • turn the machine up to 95 degree Celsius to separate the double stranded DNA for 3 minutes.
  • Then decrease the temperature to 57 degree Celsius for 30 seconds for the primers to bind to the separated DNA strand, forming the

new double stranded DNA.

  • Then turn the temperature up to 72 degree Celsius for polymerization.
  • Repeat the temperature adjustment cycle for 34-35 cycles.

DNA Measurement Protocol

  • After you add SYBR Green to the duplicated DNA sample, place the resulting DNA strand into a fluorimeter.
  • Shine light onto the sample and use a photo-taking device to record the picture of the glowing sample.
  • Use imagej to calculate the INTDEN.
  • Redo the process for a control group sample, in which the sample does not contain the DNA strand or segment that causes a certain


Research and Development

Background on Disease Markers

The disease marker being used is SNP (single nucleotide polymorphism) rs35685286. This is the marker for sickle-cell disease found on chromosome 11. Patients with sickle-cell disease have red blood cells that are mishapen and are a "sickled" or crescent shape. This results in less oxygen being carried to the patient's body tissues. Therefore, patients experience crisis, where they have severe pain in their bones in their backs or chest. These symptoms can last for hours or even days.

More information about this particular SNP can be found at: http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=35685286

Primer Design

The forward primer for this disease is ACTCCGGACCCGTCCAACCAT and the reverse primer for a patient without sickle-cell disease would be TGAGGCCTGGGCAGGGTTGGTA. If a patient were to be positive for sickle-cell disease, their reverse primer would be TGAGGCCTGGACAGGTTGGTA. Therefore, a patient with this disease experiences the gene mutation from G binding to C to G binding to A. A positive test will be recognizable because while the DNA is replicating during the PCR process, the reverse primers will only attach to the diseased patient's DNA. Consequently, when the reaction is complete and the SYBR green is added, the diseased patient's DNA will appear to glow green. If a patient does not have the disease, their DNA will be present in single strands and will appear clear when injected with SYBR green.


Description of image

Step A shows the PCR heating up to 95 degrees Celcius so the hydrogen bonds between the base pairs of the double stranded DNA can be melted and separated. Next in step B, the machine is cooled to 50 degrees Celcius where the reverse primers come in and attach to the single DNA strands to create two new double stranded DNA. Finally in step C, the PCR machine is heated up to 72 degrees Celcius and the strands are fully replicated and the process repeats for approximately 30 cycles.