Difference between revisions of "AU Biomaterials Design Lab:Materials/ADA Gene"

From OpenWetWare
Jump to: navigation, search
(New page: == Gene Sequence== The Adenosine Deaminase Sequence from [http://www.addgene.org/25576/ addGene, Plasmid 25576: Py-ADA] GAAATAAAGTTCCTCAAAAAGGAAGATGTACAAAACATCGATTTAAACGGAATGAGTAAAAAAGAA...)
 
(No difference)

Latest revision as of 13:51, 9 October 2012

Gene Sequence

The Adenosine Deaminase Sequence from addGene, Plasmid 25576: Py-ADA

GAAATAAAGTTCCTCAAAAAGGAAGATGTACAAAACATCGATTTAAACGGAATGAGTAAAAAAGAAAGAT ATGAAATATGGAGAAGAATTCCCAAAGTTGAATTACATTGCCATTTAGATTTAACATTTTCTGCTGAATT TTTTTTAAAATGGGCTCGAAAATATAATCTACAACCTAACATGTCAGATGACGAAATACTTGATCATTAT TTATTTACAAAAGAAGGAAAATCATTAGCAGAATTTATTAGAAAAGCAATAAGTGTTTCTGATTTATATA GAGATTATGATTTTATTGAAGATTTGGCCAAATGGGCAGTTATTGAAAAATATAAAGAAGGTGTTGTTTT AATGGAATTTCGATATTCACCAACTTTTGTTTCTTCATCTTATGGATTAGATGTAGAATTGATTCATAAA GCATTTATAAAAGGAATAAAAAATGCTACAGAATTATTAAACAATAAAATACATGTTGCATTAATATGTA TTAGTGATACTGGACATGCTGCTGCTAGTATTAAACATTCTGGAGATTTTGCAATTAAACATAAACATGA TTTCGTTGGTTTTGATCATGGTGGACGTGAAATAGATTTAAAAGATCATAAAGATGTATATCATTCAGTT AGGGATCATGGTTTACATCTAACTGTACATGCAGGTGAAGATGCAACTTTACCAAATCTAAATACTTTAT ATACTGCTATCAATATTTTAAATGTTGAACGTATTGGTCATGGTATAAGAGTTTCAGAATCAGATGAACT AATTGAATTAGTTAAAAAAAAAGATATCTTATTAGAAGTATGCCCAATATCTAATCTTTTATTAAATAAT GTTAAATCTATGGATACACATCCAATTAGAAAATTATATGATGCTGGTGTTAAAGTATCTGTTAATTCCG ATGATCCTGGAATGTTTTTATCAAACATAAATGATAATTACGAAAAATTATATATCCATCTAAATTTTAC ATTAGAAGAATTTATGATTATGAATAACTGGGCTTTTGAAAAATCTTTCGTTAGTGACGATGTTAAAAGC GAGCTTAAAGCGTTGTACTTT