840:153g:Projects/project27

From OpenWetWare
Revision as of 11:17, 6 December 2012 by Austin W. Jones (talk | contribs)
Jump to: navigation, search

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext">09/18/2012,09/20/2012,09/26/2012,09/27/2012,10/02/2012,10/09/2012,10/11/2012,10/16/2012,10/18/2012,10/23/2012,10/25/2012,10/30/2012,11/01/2012,11/06/2012,11/08/2012,11/13/2012,11/15/2012,11/17/2012,11/28/2012,11/29/2012</div><div style="display:none;" id="page">840:153g:Projects/project27</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html>

Team Members

  • Austin Jones
  • Jace Dolphin

Expression of methane monooxygenase in E. coli for biodegradation of methane

  • A small group of bacteria are termed methanotrophs (e.g. Methylomonas sp., Methylosinus sp., Methylocystis sp.), in that they have the ability to oxidize the C-H bond in methane. This allows methanotrophs the unique ability to not only grow using methane as the sole carbon source, but to oxidize a wide range of hydrocarbons, including chlorinated compounds. For this reason, this group of bacteria has been the focus of research concerning the bioremediation of various environmental pollutants, including the two focused on in this project: petroleum and trichloroethylene (TCE).[1]
  • This catalytic ability comes from the soluble enzyme system, methane monooxygenase (MMO), which consists of three enzyme groups[2] coded for by a ~10kb gene cluster.[3] We will attempt to clone two segments of the gene cluster E. coli. The sequences for the genes mmoX and mmoY will be included in one segment, and the sequences for the genes mmoB, mmoZ, mmoD, and mmoC will be in the other sequence. The ability of the transformed E. coli cells to show methanotrophic metabolism will be tested by quantifying their ability to oxidize methane and TCE.


  • Gene Accession Number: X55394 [4]
  • PCR Primers:
  27F_mmoXY - 5' gaattcgcggccgcttctagatggcgatcagtctcgctac 3'
  27R_mmoXY - 5' ctgcagcggccgctactagtatcagttgtcgggcgtaatcg 3'
  27F_mmoBZDC - 5' gaattcgcggccgcttctagatgtccagcgctcataacgc 3'
  27R_mmoBZDC - 5' ctgcagcggccgctactagtatcagccgctcgccaggaatt 3'
  • Vectors: pSB1A3 (ampicillin R.) [5], pSB1K3 (kanamycin R.) [6]
  • Promoter: BBa_J23100 [7]
  • Project Steps:

-DNA Extraction

-PCR – 2 genes amplified

-Digestion/Ligation

 X-Y - pSB1A3 (ampicillin R.)
 B-Z-D-C - pSB1K3 (kanamycin R.)

-Clone each into E. coli, grow on media, add appropriate antibiotic after each round

-Test ability to digest methane, TCE

 -Potassium permanganate
   -If methanol is present, solution will turn blue and produce odor
 -Tryptophan
    -Test for glyoxylic acid (byproduct of TCE digestion)
    -Tryptophan will react with glyoxylic acid and form a red/violet precipitate in solution
  • Powerpoint [8]

Reference Materials:


-Shigematsu, Toru, Satoshi Hanada, Masahiro Eguchi, and Yoichi Kamagata. "Soluble Methane Monooxygenase Gene Clusters from Trichloroethylene-Degrading Methylomonas sp. Strains and Detection of Methanotrophs during In Situ Bioremediation." APPLIED AND ENVIRONMENTAL MICROBIOLOGY 65.12 (1999): 5198-206. NCBI. NIH, Dec. 1999. Web. 27 Aug. 2012. <http://www.ncbi.nlm.nih.gov/pmc/articles/PMC91705/pdf /am005198.pdf>.


-Maarten Merkx Dr., Daniel A. Kopp, Matthew H. Sazinsky, Jessica L. Blazyk, Jens Müller Dr., Stephen J. Lippard Prof. Dr.

      "Dioxygen Activation and Methane Hydroxylation by Soluble Methane Monooxygenase: A Tale of Two Irons and Three Proteins."  Angew. Chem. Int.  2001, 40: 2782-2807 http://onlinelibrary.wiley.com/doi/10.1002/1521-3773(20010803)40:15%3C2782::AID-ANIE2782%3E3.0.CO;2-P/full



=Important Results and Milestones==
  • keep track of your most important results and refer to the corresponding page in your notebook
  • upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).
Recent changes

18 October 2017

     19:09  BME100 f2017:Group10 W0800 L4‎ (diff | hist) . . (+1). . Osvaldo J Pagan (talk | contribs)

     15:56 

BME100 f2017:Group8 W1030 L4‎‎ (2 changes | history) . . (+426). . [Jennifer L. Brodsky‎; Jacob Tomas Harrison Haye‎]

     

15:56

(cur | prev) . . (+409). . Jennifer L. Brodsky (talk | contribs) (Research and Development)

     

14:17

(cur | prev) . . (+17). . Jacob Tomas Harrison Haye (talk | contribs) (SNP Information & Primer Design)

     15:20  BME100 f2017:Group7 W0800 L4‎ (diff | hist) . . (-4). . Miguel R. Almanza Lopez (talk | contribs) (OUR TEAM)

     15:16 

(Upload log). .

[Teleah Hancer‎; Miguel R. Almanza Lopez‎; Emily A. Hanzlick‎; Kaifu Chen‎ (2×); Jacob Tomas Harrison Haye‎ (4×); Alivia Ankrum‎ (8×)]

     

15:16

. . Miguel R. Almanza Lopez (talk | contribs) uploaded File:MralPoopy.jpg

     

14:39

. . Kaifu Chen (talk | contribs) uploaded File:Jcm.jpg

     

14:38

. . Kaifu Chen (talk | contribs) uploaded File:Wgy.jpg

     

14:25

. . Jacob Tomas Harrison Haye (talk | contribs) uploaded a new version of File:DNA4.jpg

     

14:25

. . Jacob Tomas Harrison Haye (talk | contribs) uploaded a new version of File:DNA4.jpg

     

14:22

. . Jacob Tomas Harrison Haye (talk | contribs) uploaded a new version of File:DNA3.jpg

     

14:18

. . Jacob Tomas Harrison Haye (talk | contribs) uploaded File:DNA4.jpg

     

14:18

. . Alivia Ankrum (talk | contribs) uploaded File:Badg12.png

     

14:10

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Goodresultsg12.png

     

14:07

. . Alivia Ankrum (talk | contribs) uploaded File:Goodresultsg12.png

     

14:06

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Screenshot1.png

     

13:43

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Screen Shot 2017-10-18 at 1.26.01 PM.png

     

13:41

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Screen Shot 2017-10-18 at 1.26.01 PM.png

     

13:41

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Screen Shot 2017-10-18 at 1.26.01 PM.png

     

13:39

. . Alivia Ankrum (talk | contribs) uploaded File:Screen Shot 2017-10-18 at 1.26.01 PM.png

     

13:28

. . Emily A. Hanzlick (talk | contribs) uploaded File:PolymearseChainReactionExtraCreditImageEAH.png

     

13:25

. . Teleah Hancer (talk | contribs) uploaded a new version of File:Teleah6.png

     14:40 

BME100 f2017:Group1 W1030 L4‎‎ (17 changes | history) . . (+1,361). . [Abby E. Krell‎ (7×); Emily A. Hanzlick‎ (10×)]

     

14:40

(cur | prev) . . (+33). . Abby E. Krell (talk | contribs) (Protocol)

     

14:39

(cur | prev) . . (+28). . Abby E. Krell (talk | contribs) (Protocol)

     

14:38

(cur | prev) . . (+220). . Abby E. Krell (talk | contribs) (Protocol)

     

14:35

(cur | prev) . . (+178). . Abby E. Krell (talk | contribs) (Protocol)

     

14:32

(cur | prev) . . (+4). . Abby E. Krell (talk | contribs) (Research and Development)

     

14:32

(cur | prev) . . (0). . Abby E. Krell (talk | contribs) (Research and Development)

     

14:30

(cur | prev) . . (+17). . Abby E. Krell (talk | contribs) (Protocol)

     

14:01

(cur | prev) . . (+23). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:59

(cur | prev) . . (-12). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:56

(cur | prev) . . (+5). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:41

(cur | prev) . . (+177). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:36

(cur | prev) . . (+427). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:31

(cur | prev) . . (+153). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:30

(cur | prev) . . (+63). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:29

(cur | prev) . . (0). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:29

(cur | prev) . . (+6). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:25

(cur | prev) . . (+39). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     14:19 

BME100 f2017:Group12 W1030 L4‎‎ (8 changes | history) . . (+713). . [Alivia Ankrum‎ (8×)]

     

14:19

(cur | prev) . . (0). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

14:19

(cur | prev) . . (+30). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

14:14

(cur | prev) . . (0). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

14:13

(cur | prev) . . (+38). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

13:36

(cur | prev) . . (+30). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

13:35

(cur | prev) . . (+53). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

13:32

(cur | prev) . . (+8). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

13:31

(cur | prev) . . (+554). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     13:57 

BME100 f2017:Group11 W1030 L4‎‎ (4 changes | history) . . (-98). . [Teleah Hancer‎; Zoe Marmitt‎ (3×)]

     

13:57

(cur | prev) . . (-1). . Zoe Marmitt (talk | contribs) (Protocol)

     

13:53

(cur | prev) . . (+2). . Zoe Marmitt (talk | contribs) (Protocol)

     

13:52

(cur | prev) . . (-108). . Zoe Marmitt (talk | contribs) (Protocol)

     

13:25

(cur | prev) . . (+9). . Teleah Hancer (talk | contribs) (OUR TEAM)