Difference between revisions of "840:153g:Projects/project27"

From OpenWetWare
Jump to: navigation, search
(fix raw html help text)
 
(2 intermediate revisions by one other user not shown)
Line 10: Line 10:
 
<!-- ## END search column  ## -->
 
<!-- ## END search column  ## -->
 
|-  
 
|-  
|colspan="2" style="background-color: #F2F2F2;" align="right"|[[{{FULLPAGENAME}}/Entry_Base|Customize your entry pages]] [[Help:Notebook/Project_Base/Customize_entry_page|<html><img src="/images/a/aa/Help.png" border="0" /></html>]]
+
|colspan="2" style="background-color: #F2F2F2;" align="right"|[[{{FULLPAGENAME}}/Entry_Base|Customize your entry pages]] [[Image:Help.png|frameless|link=Help:Notebook/Project_Base/Customize_entry_page]]
 
|-  
 
|-  
 
|colspan="2"|
 
|colspan="2"|
Line 30: Line 30:
 
   27R_mmoBZDC - 5' ctgcagcggccgctactagtatcagccgctcgccaggaatt 3'
 
   27R_mmoBZDC - 5' ctgcagcggccgctactagtatcagccgctcgccaggaatt 3'
  
* Vectors: pSB1A3 (ampicillin R.) [http://partsregistry.org/wiki/index.php?title=Part:pSB1A3], pSB1K3 (kanamycin R.) [http://partsregistry.org/wiki/index.php?title=Part:pSB1K3]
+
* Vectors: J61002 (ampicillin R.) [http://partsregistry.org/Part:BBa_J61002], pSB1K3 (kanamycin R.) [http://partsregistry.org/wiki/index.php?title=Part:pSB1K3]
  
 
* Promoter: BBa_J23100 [http://partsregistry.org/wiki/index.php/Part:BBa_J23100]
 
* Promoter: BBa_J23100 [http://partsregistry.org/wiki/index.php/Part:BBa_J23100]
Line 36: Line 36:
 
*Project Steps:
 
*Project Steps:
  
-DNA Extraction
+
-Genomic DNA Extraction from ''M. trichosporium''
  
-PCR – 2 genes amplified
+
-PCR – 2 gene regions amplified from MMO gene cluster
  
-Digestion/Ligation
+
-Digestion/Ligation/Transformation
   X-Y - pSB1A3 (ampicillin R.)
+
   1. X-Y -> J61002 (ampicillin R.)
   B-Z-D-C - pSB1K3 (kanamycin R.)
+
    - J23100 promoter ligated into J61002 plasmid
 +
    - Transform and grow ''E. coli'' with ligation, extract plasmid DNA
 +
    - Then, amplified gene sequence and plasmid-promoter complex digested with same enzymes, ligate together
 +
    - Result should be insertion of gene sequence into J61002 plasmid, downstream of J23100 promoter
 +
   2. B-Z-D-C -> pSB1K3 (kanamycin R.)
 +
    - J23100 promoter ligated into pSB1K3 plasmid
 +
    - Transform and grow ''E. coli'' with ligation, extract plasmid DNA
 +
    - Then, amplified gene sequence and plasmid-promoter complex digested with same enzymes, ligate together
 +
    - Result should be insertion of gene sequence into pSB1K3 plasmid, downstream of J23100 promoter
  
 
-Clone each into E. coli, grow on media, add appropriate antibiotic after each round
 
-Clone each into E. coli, grow on media, add appropriate antibiotic after each round

Latest revision as of 18:21, 23 September 2017

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext">09/18/2012,09/20/2012,09/26/2012,09/27/2012,10/02/2012,10/09/2012,10/11/2012,10/16/2012,10/18/2012,10/23/2012,10/25/2012,10/30/2012,11/01/2012,11/06/2012,11/08/2012,11/13/2012,11/15/2012,11/17/2012,11/28/2012,11/29/2012</div><div style="display:none;" id="page">840:153g:Projects/project27</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages Help.png

Team Members

  • Austin Jones
  • Jace Dolphin

Expression of methane monooxygenase in E. coli for biodegradation of methane

  • A small group of bacteria are termed methanotrophs (e.g. Methylomonas sp., Methylosinus sp., Methylocystis sp.), in that they have the ability to oxidize the C-H bond in methane. This allows methanotrophs the unique ability to not only grow using methane as the sole carbon source, but to oxidize a wide range of hydrocarbons, including chlorinated compounds. For this reason, this group of bacteria has been the focus of research concerning the bioremediation of various environmental pollutants, including the two focused on in this project: petroleum and trichloroethylene (TCE).[1]
  • This catalytic ability comes from the soluble enzyme system, methane monooxygenase (MMO), which consists of three enzyme groups[2] coded for by a ~10kb gene cluster.[3] We will attempt to clone two segments of the gene cluster E. coli. The sequences for the genes mmoX and mmoY will be included in one segment, and the sequences for the genes mmoB, mmoZ, mmoD, and mmoC will be in the other sequence. The ability of the transformed E. coli cells to show methanotrophic metabolism will be tested by quantifying their ability to oxidize methane and TCE.


  • Gene Accession Number: X55394 [4]
  • PCR Primers:
  27F_mmoXY - 5' gaattcgcggccgcttctagatggcgatcagtctcgctac 3'
  27R_mmoXY - 5' ctgcagcggccgctactagtatcagttgtcgggcgtaatcg 3'
  27F_mmoBZDC - 5' gaattcgcggccgcttctagatgtccagcgctcataacgc 3'
  27R_mmoBZDC - 5' ctgcagcggccgctactagtatcagccgctcgccaggaatt 3'
  • Vectors: J61002 (ampicillin R.) [5], pSB1K3 (kanamycin R.) [6]
  • Promoter: BBa_J23100 [7]
  • Project Steps:

-Genomic DNA Extraction from M. trichosporium

-PCR – 2 gene regions amplified from MMO gene cluster

-Digestion/Ligation/Transformation

 1. X-Y -> J61002 (ampicillin R.)
    - J23100 promoter ligated into J61002 plasmid
    - Transform and grow E. coli with ligation, extract plasmid DNA
    - Then, amplified gene sequence and plasmid-promoter complex digested with same enzymes, ligate together
    - Result should be insertion of gene sequence into J61002 plasmid, downstream of J23100 promoter
 2. B-Z-D-C -> pSB1K3 (kanamycin R.)
    - J23100 promoter ligated into pSB1K3 plasmid
    - Transform and grow E. coli with ligation, extract plasmid DNA
    - Then, amplified gene sequence and plasmid-promoter complex digested with same enzymes, ligate together
    - Result should be insertion of gene sequence into pSB1K3 plasmid, downstream of J23100 promoter

-Clone each into E. coli, grow on media, add appropriate antibiotic after each round

-Test ability to digest methane, TCE

 -Potassium permanganate
   -If methanol is present, solution will turn blue and produce odor
 -Tryptophan
    -Test for glyoxylic acid (byproduct of TCE digestion)
    -Tryptophan will react with glyoxylic acid and form a red/violet precipitate in solution
  • Proposal Powerpoint [8]
  • Results Powerpoint [9]

Reference Materials:


-Shigematsu, Toru, Satoshi Hanada, Masahiro Eguchi, and Yoichi Kamagata. "Soluble Methane Monooxygenase Gene Clusters from Trichloroethylene-Degrading Methylomonas sp. Strains and Detection of Methanotrophs during In Situ Bioremediation." APPLIED AND ENVIRONMENTAL MICROBIOLOGY 65.12 (1999): 5198-206. NCBI. NIH, Dec. 1999. Web. 27 Aug. 2012. <http://www.ncbi.nlm.nih.gov/pmc/articles/PMC91705/pdf /am005198.pdf>.


-Maarten Merkx Dr., Daniel A. Kopp, Matthew H. Sazinsky, Jessica L. Blazyk, Jens Müller Dr., Stephen J. Lippard Prof. Dr.

      "Dioxygen Activation and Methane Hydroxylation by Soluble Methane Monooxygenase: A Tale of Two Irons and Three Proteins."  Angew. Chem. Int.  2001, 40: 2782-2807 http://onlinelibrary.wiley.com/doi/10.1002/1521-3773(20010803)40:15%3C2782::AID-ANIE2782%3E3.0.CO;2-P/full



=Important Results and Milestones==
  • keep track of your most important results and refer to the corresponding page in your notebook
  • upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).
Recent changes

25 September 2017

     06:18 

(Upload log). .

[Anshul Krishnan‎ (2×)]

     

06:18

. . Anshul Krishnan (talk | contribs) uploaded File:BME100TempVTrials.png

     

06:10

. . Anshul Krishnan (talk | contribs) uploaded File:BME100L3Temp.png

24 September 2017

N    22:33  MediaWiki:Tagline‎ (diff | hist) . . (+16). . Yardena Cohen (talk | contribs) (less parsing)
N    22:32  MediaWiki:Pagetitle-view-mainpage‎ (diff | hist) . . (+11). . Yardena Cohen (talk | contribs) (less parsing)
N    22:32  MediaWiki:Opensearch-desc‎ (diff | hist) . . (+16). . Yardena Cohen (talk | contribs) (english-only?)
N    21:21  MediaWiki:Pagetitle‎ (diff | hist) . . (+16). . Yardena Cohen (talk | contribs) (idk if this will help or hurt)
N    21:18  MediaWiki:Aboutsite‎ (diff | hist) . . (+17). . Yardena Cohen (talk | contribs) (one less thing to parse)

     20:08 

(Upload log). .

[Anna Hoge‎ (2×)]

     

20:08

. . Anna Hoge (talk | contribs) uploaded File:AHgraph4.png

     

18:52

. . Anna Hoge (talk | contribs) uploaded File:AHgraph3.png

23 September 2017

     17:17  MediaWiki:Contactpage-pagetext‎ (diff | hist) . . (+36). . Yardena Cohen (talk | contribs) (don't ask me science questions plz)

     17:05 

(Deletion log). .

[Yardena Cohen‎ (6×)]

     

17:05

. . Yardena Cohen (talk | contribs) deleted page User talk:Deepak P Patil(Automatically deleted when merging users)

     

17:05

. . Yardena Cohen (talk | contribs) deleted page User:Deepak P Patil(Automatically deleted when merging users)

     

16:39

. . Yardena Cohen (talk | contribs) deleted page User talk:Chun H Hsieh(Automatically deleted when merging users)

     

16:39

. . Yardena Cohen (talk | contribs) deleted page User:Chun H Hsieh(Automatically deleted when merging users)

     

15:39

. . Yardena Cohen (talk | contribs) deleted page User talk:Satu Strandman(Automatically deleted when merging users)

     

15:39

. . Yardena Cohen (talk | contribs) deleted page User:Satu Strandman(Automatically deleted when merging users)

     17:05 

(User merge log). .

[Yardena Cohen‎ (6×)]

     

17:05

. . Yardena Cohen (talk | contribs) Deleted user: Deepak P Patil (8544) ‎

     

17:05

. . Yardena Cohen (talk | contribs) User Deepak P Patil (8544) merged to Anonymous (0) ‎

     

16:39

. . Yardena Cohen (talk | contribs) Deleted user: Chun H Hsieh (13046) ‎

     

16:39

. . Yardena Cohen (talk | contribs) User Chun H Hsieh (13046) merged to Anonymous (0) ‎

     

15:39

. . Yardena Cohen (talk | contribs) Deleted user: Satu Strandman (13640) ‎

     

15:39

. . Yardena Cohen (talk | contribs) User Satu Strandman (13640) merged to Anonymous (0) ‎

N    14:04 

MediaWiki:Contactpage-label‎‎ (2 changes | history) . . (+7). . [Yardena Cohen‎ (2×)]

     

14:04

(cur | prev) . . (-4). . Yardena Cohen (talk | contribs) (one word so it doesn't get wrapped)

N    

13:59

(cur | prev) . . (+11). . Yardena Cohen (talk | contribs) (label text for footer?)

     14:02 

New server‎‎ (2 changes | history) . . (-137). . [Yardena Cohen‎ (2×)]

     

14:02

(cur | prev) . . (+10). . Yardena Cohen (talk | contribs) (contact form)

     

11:34

(cur | prev) . . (-147). . Yardena Cohen (talk | contribs) (it happened)

N    14:01 

MediaWiki:Contactpage-url‎‎ (4 changes | history) . . (+21). . [Yardena Cohen‎ (4×)]

     

14:01

(cur | prev) . . (-23). . Yardena Cohen (talk | contribs) (relative again)

     

14:01

(cur | prev) . . (-10). . Yardena Cohen (talk | contribs) (actual url)

     

13:59

(cur | prev) . . (+23). . Yardena Cohen (talk | contribs) (full url?)

N    

13:57

(cur | prev) . . (+31). . Yardena Cohen (talk | contribs) (relative link)

     13:52 

(User rights log). .

[Yardena Cohen‎ (2×)]

     

13:52

. . Yardena Cohen (talk | contribs) changed group membership for Oww Op from bureaucrat and administrator to staff ‎

     

13:52

. . Yardena Cohen (talk | contribs) changed group membership for Oww Op from (none) to administrator and bureaucrat ‎

     13:47 (User creation log) . . User account Oww Op (talk | contribs) was created by Yardena Cohen (talk | contribs) and password was sent by email ‎
     11:34 (Patrol log) . . Yardena Cohen (talk | contribs) automatically marked revision 996201 of page New server patrolled ‎
     11:33  BIOL398-04/S15:Class Assignments by Week‎ (diff | hist) . . (-3). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Tessa A. Morris Class Assignments by Week to Tessa Morris Class Assignments by Week in a maintenance job.)
     11:33  Paris Bettencourt 2012/Notebook/modularity group/day by day/2012/07‎ (diff | hist) . . (+1). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from IGEM:Paris Bettencourt 2012/Notebook/modularity group/day by day//2012/07 to IGEM:Paris Bettencourt 2012/Notebooks/modularity group/day by day//2012/07 in a maintenance job.)
     11:33  Paris Bettencourt 2012/Notebook/modularity group/day by day/2012/07/03‎ (diff | hist) . . (+1). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from IGEM:Paris Bettencourt 2012/Notebook/modularity group/day by day//2012/07/03 to IGEM:Paris Bettencourt 2012/Notebooks/modularity group/day by day//2012/07/03 in a maintenance job.)
     11:33  BIOMOD/2012/TeamSendaiA/Methods‎ (diff | hist) . . (-1). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from BIOMOD/2012/TeamSendaiA/Methodsa to Biomod/2012/TeamSendaiA/Methods in a maintenance job.)
     11:33  Biomod/2012/TU Dresden/Nanosaurs/Project/Sponsor‎ (diff | hist) . . (+1). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Biomod/2012/TU Dresden/Nanosaurs/Sponsor to Biomod/2012/TU Dresden/Nanosaurs/Sponsors in a maintenance job.)
     11:33  User:Etienne Robillard/Notebook/Phenylmethylamine‎ (diff | hist) . . (-6). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from User:Etienne Robillard/Notebook/Phenylmethanamine to User:Etienne Robillard/Notebook/Benzylamine in a maintenance job.)
     11:33  Farre Lab:Teaching & Research Program‎ (diff | hist) . . (-18). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Farre Lab:Teaching&Research Program to Farre Lab:NSF T&R in a maintenance job.)
     11:33  Farre Lab:Teaching&Research Program‎ (diff | hist) . . (-24). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Farre Lab:Farre-Teaching&Research Program to Farre Lab:NSF T&R in a maintenance job.)
     11:33  Farre Lab:Farre-Teaching&Research Program‎ (diff | hist) . . (-21). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Farre Lab:NSFTeaching&Research Program to Farre Lab:NSF T&R in a maintenance job.)
     11:33  User:Etienne Robillard/Notebook/Chemtrails911 notebook/Agent Ecoli:PhotoReceptorComponent‎ (diff | hist) . . (-26). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from User:Etienne Robillard/Notebook/Agent Ecoli:PhotoReceptorComponent to User:Etienne Robillard/Notebook/Agent BZ in a maintenance job.)
     11:33  BIOX‎ (diff | hist) . . (+9). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Liu BioX to Template:Liu BioX in a maintenance job.)
     11:33  User:Kodipad Shafahed‎ (diff | hist) . . (+5). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from King jazz to User:King jazz in a maintenance job.)
     11:33  User talk:Kodipad Shafahed‎ (diff | hist) . . (+5). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Talk:King jazz to User talk:King jazz in a maintenance job.)
     11:33  User talk:Sen Liu‎ (diff | hist) . . (+3). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Talk:LiuGroup CTGU to Talk:LiuGroup of CTGU in a maintenance job.)
     11:33  User:Eung-Sam Kim‎ (diff | hist) . . (+1). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Nanobilogy Lab to Nanobiology Lab in a maintenance job.)