Difference between revisions of "840:153g:Projects/project25"

From OpenWetWare
Jump to: navigation, search
(4 intermediate revisions by the same user not shown)
Line 17: Line 17:
 
* Colby Swanson  
 
* Colby Swanson  
  
==mreB Project Description==
+
==Cloning of mreB from ''Caulobacter crescentus'' into ''E. coli''==
 
''To see our full project description see initial project presentation:'' [[http://openwetware.org/wiki/Image:25_Recombinant_Presentation.pdf]]
 
''To see our full project description see initial project presentation:'' [[http://openwetware.org/wiki/Image:25_Recombinant_Presentation.pdf]]
  
Line 35: Line 35:
 
* '''Gene of Interest:''' mreB from ''C. crescentus'' {Accession# NC_011916, 1,044 bp, no introns} [http://www.ncbi.nlm.nih.gov/nuccore/NC_011916.1?report=genbank&from=1733317&to=1734360]
 
* '''Gene of Interest:''' mreB from ''C. crescentus'' {Accession# NC_011916, 1,044 bp, no introns} [http://www.ncbi.nlm.nih.gov/nuccore/NC_011916.1?report=genbank&from=1733317&to=1734360]
  
* '''Primers:''' ''Forward primer:'' the first 34 bases of our gene sequence. We also added in the Biobrick enzymes EcoR1 and Xba1 in front of the primer. ''Reverse primer:'' the last 20 bases of our gene sequence. We also added in the Biobrick enzymes Pst1 and Spe1 in front of the primer.  
+
* '''Primers:''' ''Forward primer:'' the first 34 bases of our gene sequence. We also added in the Biobrick enzymes EcoR1 and Xba1 in front of the primer. ''Reverse primer:'' the last 20 bases of our gene sequence. We also added in the Biobrick enzymes Pst1 and Spe1 in front of the primer. [[http://openwetware.org/wiki/Image:Primer_Picture1.png]], [[http://openwetware.org/wiki/Image:Primer_Pic2.png]]
 +
 
 +
Forward Primer: 5' ATGTTCTCTTCCCTTTTCGGCGTGATCTCGAACG 3'                                                                             
 +
Reverse Primer: 5' CTAGGCCAGCGTGGATTCCA 3'
  
 
* '''Promoter:''' BBa_K206000 (pBad Strong Promoter). This promoter is inducible by L-arabinose. When induced, AraC binds and changes the conformation interacting with Aral1 and Aral2 operator sites, permitting transcription.  
 
* '''Promoter:''' BBa_K206000 (pBad Strong Promoter). This promoter is inducible by L-arabinose. When induced, AraC binds and changes the conformation interacting with Aral1 and Aral2 operator sites, permitting transcription.  
Line 42: Line 45:
  
 
== Procedure ==
 
== Procedure ==
* Grow ''C. crescentus'' and ''E. coli'' on the respective medias
+
* Grow ''C. crescentus'' on PYE media and ''E. coli'' on LB media
* PCR to extract mreB gene + Biobrick (BB) enzymes
+
* PCR to amplify mreB gene + Biobrick (BB) genes
* Isolate and purify mreB + BB enzymes
+
* Isolate and purify mreB + BB genes
 
* Cut mreB + BB enzymes and ligate with pSB1A3  
 
* Cut mreB + BB enzymes and ligate with pSB1A3  
 
* Perform bacterial transformation to import the plasmid into ''E. coli''
 
* Perform bacterial transformation to import the plasmid into ''E. coli''
 
* Grow E. coli bacteria on experimental plates (No ampicillin, ampicillin, and ampicillin + L-arabinose)
 
* Grow E. coli bacteria on experimental plates (No ampicillin, ampicillin, and ampicillin + L-arabinose)
 
* Verification testing by examining the physical cell shapes under a light microscope and sequence verification by sending a sample of cloned DNA to Iowa State.  
 
* Verification testing by examining the physical cell shapes under a light microscope and sequence verification by sending a sample of cloned DNA to Iowa State.  
 
  
 
==References==
 
==References==
Gitai, Z., & Yakhnina, A.A. (2012). The small protein mbiA interacts with mreB and modulates cell shape in ''caulobacter crescentus. Molecular Microbiology.'' doi: 10.1111/j.1365-2958.2012.08159.x
+
Gitai, Z., & Yakhnina, A.A. (2012). The small protein mbiA interacts with mreB and modulates cell shape in ''caulobacter crescentus. Molecular Microbiology.'' doi: 10.1111/j.1365-2958.2012.08159.x [http://www.ncbi.nlm.nih.gov/pubmed/22804814]
  
Jacobs-Wagner, C., et al. (2012). Osmolality dependent relocation of penicillin-binding protein PBP2 to the division site in ''caulobacter crescentus. Journal of Bacteriology''. doi: 10.1128
+
Jacobs-Wagner, C., et al. (2012). Osmolality dependent relocation of penicillin-binding protein PBP2 to the division site in ''caulobacter crescentus. Journal of Bacteriology''. doi: 10.1128 [http://jb.asm.org/content/early/2012/04/11/JB.00260-12]
  
  

Revision as of 08:45, 2 October 2012

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext">09/13/2012,09/20/2012,09/27/2012,10/01/2012,10/02/2012,10/04/2012,10/11/2012,10/18/2012,10/25/2012,11/01/2012,11/08/2012,11/15/2012,11/29/2012</div><div style="display:none;" id="page">840:153g:Projects/project25</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html>

Team Tango Alpha

  • Bess Lippmann
  • Colby Swanson

Cloning of mreB from Caulobacter crescentus into E. coli

To see our full project description see initial project presentation: [[1]]

The goal of our project is to clone the gene, mreB, from Caulobacter crescentus (stalked shaped cell) into Escherchia coli (rod shaped cell) to see if mreB will affect E. coli's cell shape in some way. We expect to see the E. coli cells lyse or change from their normal rod shape.

Normal E. coli cell shape [[2]] Normal C. crescentus cell shape [[3]] Lysed E. coli cells [[4]] Abnormal E. coli cells [[5]], [[6]]

MreB is a rod-shape determining gene that appears as bands or spirals encircling the cell. It is known to associate with mreC and penicillin-binding proteins to catalyze precursors for the peptidoglycan cell wall and correctly position polar bacterial proteins. It is also homologous of actin in eukaryotes.

Parts

  • Tissue Source: wild type C. crescentus CB15N (generously donated from the lab of Christine Jacobs-Wagner at Yale University)
  • Gene of Interest: mreB from C. crescentus {Accession# NC_011916, 1,044 bp, no introns} [7]
  • Primers: Forward primer: the first 34 bases of our gene sequence. We also added in the Biobrick enzymes EcoR1 and Xba1 in front of the primer. Reverse primer: the last 20 bases of our gene sequence. We also added in the Biobrick enzymes Pst1 and Spe1 in front of the primer. [[8]], [[9]]

Forward Primer: 5' ATGTTCTCTTCCCTTTTCGGCGTGATCTCGAACG 3' Reverse Primer: 5' CTAGGCCAGCGTGGATTCCA 3'

  • Promoter: BBa_K206000 (pBad Strong Promoter). This promoter is inducible by L-arabinose. When induced, AraC binds and changes the conformation interacting with Aral1 and Aral2 operator sites, permitting transcription.
  • Plasmid Vector: pSB1A3. This is a Biobrick part containing an ampicillin marker gene.

Procedure

  • Grow C. crescentus on PYE media and E. coli on LB media
  • PCR to amplify mreB gene + Biobrick (BB) genes
  • Isolate and purify mreB + BB genes
  • Cut mreB + BB enzymes and ligate with pSB1A3
  • Perform bacterial transformation to import the plasmid into E. coli
  • Grow E. coli bacteria on experimental plates (No ampicillin, ampicillin, and ampicillin + L-arabinose)
  • Verification testing by examining the physical cell shapes under a light microscope and sequence verification by sending a sample of cloned DNA to Iowa State.

References

Gitai, Z., & Yakhnina, A.A. (2012). The small protein mbiA interacts with mreB and modulates cell shape in caulobacter crescentus. Molecular Microbiology. doi: 10.1111/j.1365-2958.2012.08159.x [10]

Jacobs-Wagner, C., et al. (2012). Osmolality dependent relocation of penicillin-binding protein PBP2 to the division site in caulobacter crescentus. Journal of Bacteriology. doi: 10.1128 [11]


Recent changes

18 October 2017

     10:14 

(Upload log). .

[Sarah R. Brady‎; Alexandra Richey‎; Tajinder Uppal‎ (2×); Trevor S. Heaton‎ (4×); Irene Zhang‎ (4×); Caiden Joseph Gledhill‎ (4×)]

     

10:14

. . Tajinder Uppal (talk | contribs) uploaded File:BME100TU.PNG

     

10:13

. . Irene Zhang (talk | contribs) uploaded File:IZResultsDP.png

     

10:12

. . Irene Zhang (talk | contribs) uploaded a new version of File:IZResultsNDP.png

     

10:12

. . Irene Zhang (talk | contribs) uploaded File:IZResultsNDP.png

     

10:11

. . Trevor S. Heaton (talk | contribs) uploaded a new version of File:TSH.JPG

     

10:10

. . Trevor S. Heaton (talk | contribs) uploaded a new version of File:TSH.JPG

     

10:10

. . Trevor S. Heaton (talk | contribs) uploaded a new version of File:TSH.JPG

     

10:04

. . Tajinder Uppal (talk | contribs) uploaded File:IMG 0019.PNG

     

10:00

. . Caiden Joseph Gledhill (talk | contribs) uploaded a new version of File:Lego Scientist 5.jpg

     

10:00

. . Caiden Joseph Gledhill (talk | contribs) uploaded File:Lego Scientist 5.jpg

     

09:59

. . Irene Zhang (talk | contribs) uploaded File:NonDiseaseRPResultsIZ.png

     

09:59

. . Sarah R. Brady (talk | contribs) uploaded File:River photo.jpg(River Photo Group 7 ASU BME 100 Lab)

     

09:57

. . Caiden Joseph Gledhill (talk | contribs) uploaded File:Lego scientist 5.jpg

     

09:57

. . Trevor S. Heaton (talk | contribs) uploaded File:Tsh 6507.JPG

     

09:57

. . Alexandra Richey (talk | contribs) uploaded File:AER Primer Screenshot.png

     

09:54

. . Caiden Joseph Gledhill (talk | contribs) uploaded a new version of File:Lego scientist 7.jpg

N    10:13 

BME100 f2017:Group15 W1030 L4‎‎ (3 changes | history) . . (+4,652). . [Kylie I. Mercer‎ (3×)]

     

10:13

(cur | prev) . . (-7). . Kylie I. Mercer (talk | contribs) (Protocol)

     

09:55

(cur | prev) . . (+7). . Kylie I. Mercer (talk | contribs) (LAB 4 WRITE-UP)

N    

09:54

(cur | prev) . . (+4,652). . Kylie I. Mercer (talk | contribs) (Created page with "{|{{table}} width="800" |- |style="background-color: #EEE"|128px<span style="font-size:22px;"> BME 100 Fall 2017</span> |style="background-color...")

     10:13 

BME100 f2017:Group5 W0800 L4‎‎ (3 changes | history) . . (+2,528). . [Curran McGraw‎; Anna Hoge‎ (2×)]

     

10:13

(cur | prev) . . (+1,221). . Anna Hoge (talk | contribs) (SNP Information & Primer Design)

     

10:05

(cur | prev) . . (+1,296). . Anna Hoge (talk | contribs) (Research and Development)

     

09:54

(cur | prev) . . (+11). . Curran McGraw (talk | contribs) (OUR TEAM)

     10:12 

BME100 f2017:Group6 W0800 L4‎‎ (6 changes | history) . . (+810). . [Tajinder Uppal‎; Karmella Haynes‎ (2×); Timothy J. Oetter‎ (3×)]

     

10:12

(cur | prev) . . (-1). . Karmella Haynes (talk | contribs)

     

10:11

(cur | prev) . . (+10). . Karmella Haynes (talk | contribs)

     

10:05

(cur | prev) . . (-5). . Tajinder Uppal (talk | contribs) (OUR TEAM)

     

10:03

(cur | prev) . . (+1). . Timothy J. Oetter (talk | contribs) (SNP Information & Primer Design)

     

10:03

(cur | prev) . . (0). . Timothy J. Oetter (talk | contribs) (SNP Information & Primer Design)

     

10:02

(cur | prev) . . (+805). . Timothy J. Oetter (talk | contribs) (SNP Information & Primer Design)

     10:09 

BME100 f2017:Group9 W0800 L4‎‎ (4 changes | history) . . (+502). . [Irene Zhang‎ (4×)]

     

10:09

(cur | prev) . . (+422). . Irene Zhang (talk | contribs) (SNP Information & Primer Design)

     

10:02

(cur | prev) . . (+34). . Irene Zhang (talk | contribs) (SNP Information & Primer Design)

     

09:58

(cur | prev) . . (+7). . Irene Zhang (talk | contribs) (SNP Information & Primer Design)

     

09:57

(cur | prev) . . (+39). . Irene Zhang (talk | contribs) (SNP Information & Primer Design)

     10:06 

BME100 f2017:Group15 W0800 L4‎‎ (2 changes | history) . . (+1,520). . [Samuel J. Ramirez‎ (2×)]

     

10:06

(cur | prev) . . (+1). . Samuel J. Ramirez (talk | contribs) (Part 3: Now that you have a good view of the DNA sequence, you can design primers for PCR.)

     

10:05

(cur | prev) . . (+1,519). . Samuel J. Ramirez (talk | contribs) (Part 3: Now that you have a good view of the DNA sequence, you can design primers for PCR.)

     10:04  BME100 f2017:Group8 W0800 L4‎ (diff | hist) . . (-7). . Janet Vargas (talk | contribs)

     10:04 

User:Jesus E. Dorame‎‎ (7 changes | history) . . (-1). . [Jesus E. Dorame‎ (7×)]

     

10:04

(cur | prev) . . (+2). . Jesus E. Dorame (talk | contribs)

     

10:03

(cur | prev) . . (+2). . Jesus E. Dorame (talk | contribs) (Contact Info)

     

10:02

(cur | prev) . . (-6). . Jesus E. Dorame (talk | contribs)

     

10:00

(cur | prev) . . (+5). . Jesus E. Dorame (talk | contribs)

     

10:00

(cur | prev) . . (-10). . Jesus E. Dorame (talk | contribs)

     

09:57

(cur | prev) . . (+19). . Jesus E. Dorame (talk | contribs)

     

09:56

(cur | prev) . . (-13). . Jesus E. Dorame (talk | contribs)

     10:02  BME100 f2017:Group4 W0800 L4‎ (diff | hist) . . (+81). . Ally M. Coen (talk | contribs) (Research and Development)
     10:00  BME100 f2017:Group7 W1030 L4‎ (diff | hist) . . (-2). . Sarah R. Brady (talk | contribs) (OUR TEAM)

     09:59 

BME100 f2017:Group1 W0800 L4‎‎ (4 changes | history) . . (+33). . [Matthew A. Tam‎; Caiden Joseph Gledhill‎; Alexandra Richey‎ (2×)]

     

09:59

(cur | prev) . . (-1). . Alexandra Richey (talk | contribs) (SNP Information & Primer Design)

     

09:57

(cur | prev) . . (+3). . Caiden Joseph Gledhill (talk | contribs) (OUR TEAM)

     

09:56

(cur | prev) . . (+35). . Alexandra Richey (talk | contribs) (SNP Information & Primer Design)

     

09:54

(cur | prev) . . (-4). . Matthew A. Tam (talk | contribs) (Protocol)

     09:58  User:Trevor S. Heaton‎ (diff | hist) . . (+21). . Trevor S. Heaton (talk | contribs) (Contact Info)
     09:57  BME100 f2017:Group12 W0800 L4‎ (diff | hist) . . (+26). . Priscilla Y. Han (talk | contribs) (SNP Information & Primer Design)