Difference between revisions of "840:153g:Projects/project25"

From OpenWetWare
Jump to: navigation, search
(16 intermediate revisions by the same user not shown)
Line 13: Line 13:
 
|-  
 
|-  
 
|colspan="2"|
 
|colspan="2"|
==Team Members==
+
==Team Tango Alpha==
 
* Bess Lippmann
 
* Bess Lippmann
 
* Colby Swanson  
 
* Colby Swanson  
  
==mreB Project Description==
+
==Cloning of mreB from ''Caulobacter crescentus'' into ''E. coli''==
* Explain your experimental design here
+
''To see our full project description see initial project presentation:'' [[http://openwetware.org/wiki/Image:25_Recombinant_Presentation.pdf]]
* List all the steps that are needed to complete your project
+
 
* Do not go into experimental details and don't list procedures. Just list the major steps necessary to complete your project
+
The goal of our project is to clone the gene, mreB, from ''Caulobacter crescentus'' (stalked shaped cell) into ''Escherchia coli'' (rod shaped cell) to see if mreB will affect ''E. coli's'' cell shape in some way. We expect to see the ''E. coli'' cells lyse or change from their normal rod shape.
* Please also make yourself familiar with uploading pictures and *.ppt files
+
 
 +
Normal ''E. coli'' cell shape [[http://openwetware.org/wiki/Image:E._coli_normal_cells]]
 +
Normal ''C. crescentus'' cell shape [[http://openwetware.org/wiki/Image:C._crescentus.jpg]]
 +
Lysed ''E. coli'' cells [[http://openwetware.org/wiki/Image:E._coli_cell_lysis.jpg]]
 +
Abnormal ''E. coli'' cells [[http://openwetware.org/wiki/Image:Morphed_e._coli_cells.gif]], [[http://openwetware.org/wiki/Image:E.Coli_MreB.jpg]]
 +
 
 +
MreB is a rod-shape determining gene that appears as bands or spirals encircling the cell. It is known to associate with mreC and penicillin-binding proteins to catalyze precursors for the peptidoglycan cell wall and correctly position polar bacterial proteins. It is also homologous of actin in eukaryotes. 
 +
 
 +
== Parts ==
 +
 
 +
* '''Tissue Source:''' wild type ''C. crescentus'' CB15N (generously donated from the lab of Christine Jacobs-Wagner at Yale University)
 +
 
 +
* '''Gene of Interest:''' mreB from ''C. crescentus'' {Accession# NC_011916, 1,044 bp, no introns} [http://www.ncbi.nlm.nih.gov/nuccore/NC_011916.1?report=genbank&from=1733317&to=1734360]
 +
 
 +
* '''Primers:''' ''Forward primer:'' the first 34 bases of our gene sequence. We also added in the Biobrick enzymes EcoR1 and Xba1 in front of the primer. ''Reverse primer:'' the last 20 bases of our gene sequence. We also added in the Biobrick enzymes Pst1 and Spe1 in front of the primer. [[http://openwetware.org/wiki/Image:Primer_Picture1.png]], [[http://openwetware.org/wiki/Image:Primer_Pic2.png]]
 +
 
 +
Forward Primer: 5' ATGTTCTCTTCCCTTTTCGGCGTGATCTCGAACG 3'                                                                             
 +
Reverse Primer: 5' CTAGGCCAGCGTGGATTCCA 3'
 +
 
 +
* '''Promoter:''' BBa_K206000 (pBad Strong Promoter). This promoter is inducible by L-arabinose. When induced, AraC binds and changes the conformation interacting with Aral1 and Aral2 operator sites, permitting transcription.
 +
 
 +
* '''Plasmid Vector:''' pSB1A3. This is a Biobrick part containing an ampicillin marker gene.
 +
 
 +
== Procedure ==
 +
* Grow ''C. crescentus'' on PYE media and ''E. coli'' on LB media
 +
* PCR to amplify mreB gene + Biobrick (BB) genes
 +
* Isolate and purify mreB + BB genes
 +
* Cut mreB + BB enzymes and ligate with pSB1A3
 +
* Perform bacterial transformation to import the plasmid into ''E. coli''
 +
* Grow E. coli bacteria on experimental plates (No ampicillin, ampicillin, and ampicillin + L-arabinose)
 +
* Verification testing by examining the physical cell shapes under a light microscope and sequence verification by sending a sample of cloned DNA to Iowa State.
 +
 
 +
==References==
 +
Gitai, Z., & Yakhnina, A.A. (2012). The small protein mbiA interacts with mreB and modulates cell shape in ''caulobacter crescentus. Molecular Microbiology.'' doi: 10.1111/j.1365-2958.2012.08159.x [http://www.ncbi.nlm.nih.gov/pubmed/22804814]
 +
 
 +
Jacobs-Wagner, C., et al. (2012). Osmolality dependent relocation of penicillin-binding protein PBP2 to the division site in ''caulobacter crescentus. Journal of Bacteriology''. doi: 10.1128 [http://jb.asm.org/content/early/2012/04/11/JB.00260-12]
  
==Important Results and Milestones==
 
* keep track of your most important results and refer to the corresponding page in your notebook
 
* upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).
 
  
 
|-
 
|-

Revision as of 08:45, 2 October 2012

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext">09/13/2012,09/20/2012,09/27/2012,10/01/2012,10/02/2012,10/04/2012,10/11/2012,10/18/2012,10/25/2012,11/01/2012,11/08/2012,11/15/2012,11/29/2012</div><div style="display:none;" id="page">840:153g:Projects/project25</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html>

Team Tango Alpha

  • Bess Lippmann
  • Colby Swanson

Cloning of mreB from Caulobacter crescentus into E. coli

To see our full project description see initial project presentation: [[1]]

The goal of our project is to clone the gene, mreB, from Caulobacter crescentus (stalked shaped cell) into Escherchia coli (rod shaped cell) to see if mreB will affect E. coli's cell shape in some way. We expect to see the E. coli cells lyse or change from their normal rod shape.

Normal E. coli cell shape [[2]] Normal C. crescentus cell shape [[3]] Lysed E. coli cells [[4]] Abnormal E. coli cells [[5]], [[6]]

MreB is a rod-shape determining gene that appears as bands or spirals encircling the cell. It is known to associate with mreC and penicillin-binding proteins to catalyze precursors for the peptidoglycan cell wall and correctly position polar bacterial proteins. It is also homologous of actin in eukaryotes.

Parts

  • Tissue Source: wild type C. crescentus CB15N (generously donated from the lab of Christine Jacobs-Wagner at Yale University)
  • Gene of Interest: mreB from C. crescentus {Accession# NC_011916, 1,044 bp, no introns} [7]
  • Primers: Forward primer: the first 34 bases of our gene sequence. We also added in the Biobrick enzymes EcoR1 and Xba1 in front of the primer. Reverse primer: the last 20 bases of our gene sequence. We also added in the Biobrick enzymes Pst1 and Spe1 in front of the primer. [[8]], [[9]]

Forward Primer: 5' ATGTTCTCTTCCCTTTTCGGCGTGATCTCGAACG 3' Reverse Primer: 5' CTAGGCCAGCGTGGATTCCA 3'

  • Promoter: BBa_K206000 (pBad Strong Promoter). This promoter is inducible by L-arabinose. When induced, AraC binds and changes the conformation interacting with Aral1 and Aral2 operator sites, permitting transcription.
  • Plasmid Vector: pSB1A3. This is a Biobrick part containing an ampicillin marker gene.

Procedure

  • Grow C. crescentus on PYE media and E. coli on LB media
  • PCR to amplify mreB gene + Biobrick (BB) genes
  • Isolate and purify mreB + BB genes
  • Cut mreB + BB enzymes and ligate with pSB1A3
  • Perform bacterial transformation to import the plasmid into E. coli
  • Grow E. coli bacteria on experimental plates (No ampicillin, ampicillin, and ampicillin + L-arabinose)
  • Verification testing by examining the physical cell shapes under a light microscope and sequence verification by sending a sample of cloned DNA to Iowa State.

References

Gitai, Z., & Yakhnina, A.A. (2012). The small protein mbiA interacts with mreB and modulates cell shape in caulobacter crescentus. Molecular Microbiology. doi: 10.1111/j.1365-2958.2012.08159.x [10]

Jacobs-Wagner, C., et al. (2012). Osmolality dependent relocation of penicillin-binding protein PBP2 to the division site in caulobacter crescentus. Journal of Bacteriology. doi: 10.1128 [11]


Recent changes

19 October 2017

     10:53  User:Peteral‎ (diff | hist) . . (+728). . Peteral (talk | contribs) (Alec's Discussion Questions)
     09:17  BioMicroCenter:BIG meeting‎ (diff | hist) . . (+19). . George W Bell (talk | contribs) (2017-2018 academic year)
     07:06 (User creation log) . . User account Newfish (talk | contribs) was created by Yar (talk | contribs) and password was sent by email ‎

     04:10 

BioMicroCenter:BioinfoClasses‎‎ (3 changes | history) . . (+132). . [Charlie Whittaker‎ (3×)]

     

04:10

(cur | prev) . . (+9). . Charlie Whittaker (talk | contribs) (Teaching Schedule)

     

04:09

(cur | prev) . . (0). . Charlie Whittaker (talk | contribs) (Teaching Schedule)

     

04:08

(cur | prev) . . (+123). . Charlie Whittaker (talk | contribs) (Teaching Schedule)

     03:36  User:Timothee Flutre‎ (diff | hist) . . (+146). . Timothee Flutre (talk | contribs) (add contrib breedR and SO)

 m   02:27 

How to write a research paper‎‎ (2 changes | history) . . (+91). . [Formand‎ (2×)]

 m   

02:27

(cur | prev) . . (-1). . Formand (talk | contribs) (External links)

 m   

02:24

(cur | prev) . . (+92). . Formand (talk | contribs) (External links)

18 October 2017

     19:09  BME100 f2017:Group10 W0800 L4‎ (diff | hist) . . (+1). . Osvaldo J Pagan (talk | contribs)

     15:56 

BME100 f2017:Group8 W1030 L4‎‎ (2 changes | history) . . (+426). . [Jennifer L. Brodsky‎; Jacob Tomas Harrison Haye‎]

     

15:56

(cur | prev) . . (+409). . Jennifer L. Brodsky (talk | contribs) (Research and Development)

     

14:17

(cur | prev) . . (+17). . Jacob Tomas Harrison Haye (talk | contribs) (SNP Information & Primer Design)

     15:20  BME100 f2017:Group7 W0800 L4‎ (diff | hist) . . (-4). . Miguel R. Almanza Lopez (talk | contribs) (OUR TEAM)

     15:16 

(Upload log). .

[Miguel R. Almanza Lopez‎; Kaifu Chen‎ (2×); Jacob Tomas Harrison Haye‎ (4×); Alivia Ankrum‎ (8×)]

     

15:16

. . Miguel R. Almanza Lopez (talk | contribs) uploaded File:MralPoopy.jpg

     

14:39

. . Kaifu Chen (talk | contribs) uploaded File:Jcm.jpg

     

14:38

. . Kaifu Chen (talk | contribs) uploaded File:Wgy.jpg

     

14:25

. . Jacob Tomas Harrison Haye (talk | contribs) uploaded a new version of File:DNA4.jpg

     

14:25

. . Jacob Tomas Harrison Haye (talk | contribs) uploaded a new version of File:DNA4.jpg

     

14:22

. . Jacob Tomas Harrison Haye (talk | contribs) uploaded a new version of File:DNA3.jpg

     

14:18

. . Jacob Tomas Harrison Haye (talk | contribs) uploaded File:DNA4.jpg

     

14:18

. . Alivia Ankrum (talk | contribs) uploaded File:Badg12.png

     

14:10

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Goodresultsg12.png

     

14:07

. . Alivia Ankrum (talk | contribs) uploaded File:Goodresultsg12.png

     

14:06

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Screenshot1.png

     

13:43

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Screen Shot 2017-10-18 at 1.26.01 PM.png

     

13:41

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Screen Shot 2017-10-18 at 1.26.01 PM.png

     

13:41

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Screen Shot 2017-10-18 at 1.26.01 PM.png

     

13:39

. . Alivia Ankrum (talk | contribs) uploaded File:Screen Shot 2017-10-18 at 1.26.01 PM.png

     14:40 

BME100 f2017:Group1 W1030 L4‎‎ (12 changes | history) . . (+1,100). . [Emily A. Hanzlick‎ (5×); Abby E. Krell‎ (7×)]

     

14:40

(cur | prev) . . (+33). . Abby E. Krell (talk | contribs) (Protocol)

     

14:39

(cur | prev) . . (+28). . Abby E. Krell (talk | contribs) (Protocol)

     

14:38

(cur | prev) . . (+220). . Abby E. Krell (talk | contribs) (Protocol)

     

14:35

(cur | prev) . . (+178). . Abby E. Krell (talk | contribs) (Protocol)

     

14:32

(cur | prev) . . (+4). . Abby E. Krell (talk | contribs) (Research and Development)

     

14:32

(cur | prev) . . (0). . Abby E. Krell (talk | contribs) (Research and Development)

     

14:30

(cur | prev) . . (+17). . Abby E. Krell (talk | contribs) (Protocol)

     

14:01

(cur | prev) . . (+23). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:59

(cur | prev) . . (-12). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:56

(cur | prev) . . (+5). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:41

(cur | prev) . . (+177). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:36

(cur | prev) . . (+427). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     14:19 

BME100 f2017:Group12 W1030 L4‎‎ (7 changes | history) . . (+159). . [Alivia Ankrum‎ (7×)]

     

14:19

(cur | prev) . . (0). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

14:19

(cur | prev) . . (+30). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

14:14

(cur | prev) . . (0). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

14:13

(cur | prev) . . (+38). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

13:36

(cur | prev) . . (+30). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

13:35

(cur | prev) . . (+53). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

13:32

(cur | prev) . . (+8). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     13:57 

BME100 f2017:Group11 W1030 L4‎‎ (3 changes | history) . . (-107). . [Zoe Marmitt‎ (3×)]

     

13:57

(cur | prev) . . (-1). . Zoe Marmitt (talk | contribs) (Protocol)

     

13:53

(cur | prev) . . (+2). . Zoe Marmitt (talk | contribs) (Protocol)

     

13:52

(cur | prev) . . (-108). . Zoe Marmitt (talk | contribs) (Protocol)