840:153g:Projects/project24

From OpenWetWare
Revision as of 11:22, 13 September 2012 by PARUL Sirohi (talk | contribs)
Jump to: navigation, search

Insert non-formatted text here{|border="1" cellpadding="4" cellspacing="0" style="border:#c9c9c9 1px solid; margin: 1em 1em 1em 0; border-collapse: collapse;" width="800" |-<nowiki>Insert non-formatted text here</nowiki> |style="background-color: #cdde95;" align="center"| <!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext">09/11/2012,09/17/2012,09/20/2012,09/27/2012,10/04/2012,10/11/2012,10/16/2012,10/18/2012,10/22/2012,10/25/2012,11/01/2012,11/08/2012,11/15/2012</div><div style="display:none;" id="page">840:153g:Projects/project24</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div> |align="center" style="background-color: #e5edc8;" | Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch> |- |colspan="2" style="background-color: #F2F2F2;" align="right"|Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html> |- |colspan="2"|

Team Members

  • Sanju Timilsina
  • Parul Sirohi

Over expression of E. coli Acetyl- CoA carboxylase (ACC)sub-unit accC in E.coli to enhance fatty acid accumulation for Bio-fuel production”.

  • Source Organism: E. coli 0157:H7

PROJECT DESCRIPTION Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids.


  • Source: Biology department of University of Northern Iowa
  • Media: Luria Broth
  • Gene: Acetyl CoA carboxylase biotin carboxylase (accC)
  • Accession no.: NC_011353.1 Region: 4242644..4243993 total base pair- 1350
  • Introns: None because Bacteria does not have any introns.
  • Bio-brick Compatibility: Compatible
  • Plasmid used: Vector Plasmid pSB1A3
  • Promoter used:Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc


Alternative Promoters: BBa-K206000(PBad): is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC.


J23109:RFP-106 tttacagctagctcagtcctagggactgtgctagc (is medium promoter)


PCR primers for accC gene

• 24F_Biofuel1P 5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’


• 24RP_Biofuel2S 5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’


• 24F_Biofuel1 5’ atgctggataaaattgttattgccaaccgc 3’


• 24RP_Biofuel2 5’ cgagttttttctccagatagtggatgttagtgc3’


'''Steps for project:'''


• Grow the source organism (E. coli)


• DNA extraction from the source (E. coli)


• Electrophoresis to check desired DNA segment (bp)


• Primer designing


• Multiplication of gene of interest by PCR


• Electrophorosis


• Digestion of Plasmid and gene by restriction enzymes


• Ligation of accC gene in plasmid vector (pSB1A3)


• Transformation of vector plasmid into host organism E. coli


• Cloning of cells in a LB media


• Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin)


• Inoculation of E.coli in biomass


• Testing of protein Acetyl CoA carboxylase biotin carboxylage by SDS-PAGE and fatty acid by thin layer chromatography


References:


• Magnuson, K., Jackowski, S., Rock, C.O., and Cronan, J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli. Microbial Rev.57(3):522


• Noemie, M. D., Parisien, A., Wang, B., Lan, C., ( 2009). Enhancement of lipid production using biochemical, genetic and transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41


http://partsregistry.org/Main_Page


http://www.ncbi.nlm.nih.gov/


http://scholar.google.com/

Presentation:

Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx (file)
http://openwetware.org/images/4/42/Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx

Important Results and Milestones

  • keep track of your most important results and refer to the corresponding page in your notebook
  • upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).

|- |colspan="2" style="background-color: #F2F2F2;"|

Recent changes

18 October 2017

     14:22 

(Upload log). .

[Emily A. Hanzlick‎; Alexis A. Chavez‎; Teleah Hancer‎ (2×); Jacob Tomas Harrison Haye‎ (2×); Sarah R. Brady‎ (3×); Alivia Ankrum‎ (8×)]

     

14:22

. . Jacob Tomas Harrison Haye (talk | contribs) uploaded a new version of File:DNA3.jpg

     

14:18

. . Jacob Tomas Harrison Haye (talk | contribs) uploaded File:DNA4.jpg

     

14:18

. . Alivia Ankrum (talk | contribs) uploaded File:Badg12.png

     

14:10

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Goodresultsg12.png

     

14:07

. . Alivia Ankrum (talk | contribs) uploaded File:Goodresultsg12.png

     

14:06

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Screenshot1.png

     

13:43

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Screen Shot 2017-10-18 at 1.26.01 PM.png

     

13:41

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Screen Shot 2017-10-18 at 1.26.01 PM.png

     

13:41

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Screen Shot 2017-10-18 at 1.26.01 PM.png

     

13:39

. . Alivia Ankrum (talk | contribs) uploaded File:Screen Shot 2017-10-18 at 1.26.01 PM.png

     

13:28

. . Emily A. Hanzlick (talk | contribs) uploaded File:PolymearseChainReactionExtraCreditImageEAH.png

     

13:25

. . Teleah Hancer (talk | contribs) uploaded a new version of File:Teleah6.png

     

13:24

. . Teleah Hancer (talk | contribs) uploaded File:Teleah6.png

     

13:14

. . Sarah R. Brady (talk | contribs) uploaded File:Adriane BME 101 1.jpg

     

13:14

. . Sarah R. Brady (talk | contribs) uploaded a new version of File:Adriane BME 100.jpg

     

13:13

. . Alexis A. Chavez (talk | contribs) uploaded File:Courage.a.jpg

     

13:12

. . Sarah R. Brady (talk | contribs) uploaded File:Adriane BME 100.jpg(Adriane_BME_100)

     14:19 

BME100 f2017:Group12 W1030 L4‎‎ (8 changes | history) . . (+713). . [Alivia Ankrum‎ (8×)]

     

14:19

(cur | prev) . . (0). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

14:19

(cur | prev) . . (+30). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

14:14

(cur | prev) . . (0). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

14:13

(cur | prev) . . (+38). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

13:36

(cur | prev) . . (+30). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

13:35

(cur | prev) . . (+53). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

13:32

(cur | prev) . . (+8). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

13:31

(cur | prev) . . (+554). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     14:17  BME100 f2017:Group8 W1030 L4‎ (diff | hist) . . (+17). . Jacob Tomas Harrison Haye (talk | contribs) (SNP Information & Primer Design)

     14:01 

BME100 f2017:Group1 W1030 L4‎‎ (10 changes | history) . . (+881). . [Emily A. Hanzlick‎ (10×)]

     

14:01

(cur | prev) . . (+23). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:59

(cur | prev) . . (-12). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:56

(cur | prev) . . (+5). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:41

(cur | prev) . . (+177). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:36

(cur | prev) . . (+427). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:31

(cur | prev) . . (+153). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:30

(cur | prev) . . (+63). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:29

(cur | prev) . . (0). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:29

(cur | prev) . . (+6). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:25

(cur | prev) . . (+39). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     13:57 

BME100 f2017:Group11 W1030 L4‎‎ (4 changes | history) . . (-98). . [Teleah Hancer‎; Zoe Marmitt‎ (3×)]

     

13:57

(cur | prev) . . (-1). . Zoe Marmitt (talk | contribs) (Protocol)

     

13:53

(cur | prev) . . (+2). . Zoe Marmitt (talk | contribs) (Protocol)

     

13:52

(cur | prev) . . (-108). . Zoe Marmitt (talk | contribs) (Protocol)

     

13:25

(cur | prev) . . (+9). . Teleah Hancer (talk | contribs) (OUR TEAM)

     13:15 

BME100 f2017:Group7 W1030 L4‎‎ (2 changes | history) . . (+4). . [Sarah R. Brady‎ (2×)]

     

13:15

(cur | prev) . . (+2). . Sarah R. Brady (talk | contribs) (OUR TEAM)

     

13:13

(cur | prev) . . (+2). . Sarah R. Brady (talk | contribs) (OUR TEAM)

     13:15  BME100 f2017:Group4 W1030 L4‎ (diff | hist) . . (+1). . Alexis A. Chavez (talk | contribs) (OUR TEAM)

     13:11 

User:Mohammad H. Dezfulian‎‎ (3 changes | history) . . (+630). . [Mohammad H. Dezfulian‎ (3×)]

     

13:11

(cur | prev) . . (-3). . Mohammad H. Dezfulian (talk | contribs)

     

13:08

(cur | prev) . . (-83). . Mohammad H. Dezfulian (talk | contribs)

     

13:03

(cur | prev) . . (+716). . Mohammad H. Dezfulian (talk | contribs)

     13:04 

BioMicroCenter:BioinfoClasses‎‎ (4 changes | history) . . (+573). . [Duanduan Ma‎ (4×)]

     

13:04

(cur | prev) . . (+217). . Duanduan Ma (talk | contribs)

     

13:01

(cur | prev) . . (+151). . Duanduan Ma (talk | contribs)

     

12:57

(cur | prev) . . (0). . Duanduan Ma (talk | contribs)

     

12:55

(cur | prev) . . (+205). . Duanduan Ma (talk | contribs)

|}