840:153g:Projects/project24

From OpenWetWare
Revision as of 17:40, 11 September 2012 by Sanju Timilsina (talk | contribs)
Jump to: navigation, search

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext">09/11/2012,09/17/2012,09/20/2012,09/27/2012,10/04/2012,10/11/2012,10/16/2012,10/18/2012,10/22/2012,10/25/2012,11/01/2012,11/08/2012,11/15/2012</div><div style="display:none;" id="page">840:153g:Projects/project24</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html>

Team Members

  • Sanju Timilsina
  • Parul Sirohi

Over expression of E. coli Acetyl- CoA carboxylase (ACC)sub-unit accC in E.coli to enhance fatty acid accumulation for Bio-fuel production”.

  • Source Organism: E. coli 0157:H7�

PROJECT DESCRIPTION Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis. TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids.

Source: Biology department of University of Northern Iowa� Media: Luria Broth� Gene: Acetyl CoA carboxylase biotin carboxylase (accC)� Accession #: NC_011353.1 Region: 4242644..4243993 total base pair- 1350� Introns: None because Bacteria does not have any introns. Bio-brick Compatibility: Compatible Plasmid used: Vector Plasmid pSB1A3 Promoter used:Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc

Alternative Promoters: BBa-K206000(PBad): is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC. J23109:RFP-106 tttacagctagctcagtcctagggactgtgctagc (is medium promoter)

PCR primers for accC gene

24F_Biofuel1P 5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’ 24RP_Biofuel2S 5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’

24F_Biofuel1 5’ atgctggataaaattgttattgccaaccgc 3’ 24RP_Biofuel2 5’ cgagttttttctccagatagtggatgttagtgc3’


1.Grow the source organism (E. coli) 2.DNA extraction from the source (E. coli) 3.Electrophoresis to check desired DNA segment (bp) 4.Primer designing 5.Multiplication of gene of interest by PCR 6.Electrophorosis 7.Digestion of Plasmid and gene by restriction enzymes 8.Ligation of accC gene in plasmid vector (pSB1A3) 9.Transformation of vector plasmid into host organism E. coli 10.Cloning of cells in a LB media 11.Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin) 12.Inoculation of E.coli in biomass 13.Testing of protein Acetyl CoA carboxylase biotin carboxylage by SDS-PAGE and fatty acid by thin layer chromatography

Presentation:Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx‎ (file size: 472 KB, MIME type: application/zip)  

References:

Important Results and Milestones

  • keep track of your most important results and refer to the corresponding page in your notebook
  • upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).
Recent changes

25 September 2017

     17:38  User:Oww Bot‎ (diff | hist) . . (-956). . Yar (talk | contribs) (it me)

     17:36 

(User rights log). .

[Yar‎ (13×)]

     

17:36

. . Yar (talk | contribs) changed group membership for Oww Bot from bot and administrator to bot ‎

     

17:33

. . Yar (talk | contribs) changed group membership for Yeem from administrator to (none) ‎

     

17:33

. . Yar (talk | contribs) changed group membership for Ricardo Vidal from administrator to (none) ‎

     

17:33

. . Yar (talk | contribs) changed group membership for Reshma P. Shetty from bureaucrat and administrator to (none) ‎

     

17:32

. . Yar (talk | contribs) changed group membership for Rehears from bureaucrat and administrator to (none) ‎

     

17:31

. . Yar (talk | contribs) changed group membership for Lorrie LeJeune from bureaucrat and administrator to (none) ‎

     

17:31

. . Yar (talk | contribs) changed group membership for Jeff Brock from bureaucrat, dropboxuser and administrator to dropboxuser ‎

     

17:31

. . Yar (talk | contribs) changed group membership for Jason R. Kelly from bureaucrat and administrator to (none) ‎

     

17:31

. . Yar (talk | contribs) changed group membership for Ilya from bureaucrat, developer and administrator to developer ‎

     

17:30

. . Yar (talk | contribs) changed group membership for Bill Flanagan from bureaucrat and administrator to (none) ‎

     

17:30

. . Yar (talk | contribs) changed group membership for Barry Canton from bureaucrat and administrator to (none) ‎

     

17:29

. . Yar (talk | contribs) changed group membership for Austin J. Che from bureaucrat and administrator to (none) ‎

     

17:29

. . Yar (talk | contribs) changed group membership for Administrator from bureaucrat, developer and administrator to developer ‎

     17:35  User:Yar‎ (diff | hist) . . (+26). . Yar (talk | contribs) (my name)

     17:34 

(Move log). .

[Yar‎ (5×)]

     

17:34

. . Yar (talk | contribs) moved page User talk:Yardena Cohen to User talk:Yar(Automatically moved page while renaming the user "Yardena Cohen" to "Yar")

     

17:34

. . Yar (talk | contribs) moved page User:Yardena Cohen/Notebook/attempt/Entry Base to User:Yar/Notebook/attempt/Entry Base(Automatically moved page while renaming the user "Yardena Cohen" to "Yar")

     

17:34

. . Yar (talk | contribs) moved page User:Yardena Cohen/Notebook/attempt to User:Yar/Notebook/attempt(Automatically moved page while renaming the user "Yardena Cohen" to "Yar")

     

17:34

. . Yar (talk | contribs) moved page User:Yardena Cohen/Notebook to User:Yar/Notebook(Automatically moved page while renaming the user "Yardena Cohen" to "Yar")

     

17:34

. . Yar (talk | contribs) moved page User:Yardena Cohen to User:Yar(Automatically moved page while renaming the user "Yardena Cohen" to "Yar")

     17:34 (User rename log) . . Yar (talk | contribs) renamed user Yardena Cohen (108 edits) to Yar(shorter)
     17:28  OpenWetWare:Bureaucrats‎ (diff | hist) . . (-58). . Yar (talk | contribs) (it me)
     17:28  OpenWetWare:Administrators‎ (diff | hist) . . (-187). . Yar (talk | contribs) (it me)

     17:21 

User:Yardena Cohen‎‎ (3 changes | history) . . (+501). . [Yar‎ (3×)]

     

17:21

(cur | prev) . . (+84). . Yar (talk | contribs) (link to 1.13.2 announcement from 2008...)

     

17:16

(cur | prev) . . (+4). . Yar (talk | contribs) (contact link)

     

17:15

(cur | prev) . . (+413). . Yar (talk | contribs) (allow myself to introduce myself)

     17:17  OpenWetWare:Mailing lists‎ (diff | hist) . . (-2,426). . Yar (talk | contribs) (update)
     17:15  CONJ606:Schedule‎ (diff | hist) . . (0). . Maureen E. Hoatlin (talk | contribs) (Week-by-Week Schedule Summary)

     16:32 

PrivateWikis‎‎ (2 changes | history) . . (-8). . [Yar‎ (2×)]

     

16:32

(cur | prev) . . (+3). . Yar (talk | contribs) (23)

     

16:31

(cur | prev) . . (-11). . Yar (talk | contribs) (new contact page)

     16:32 

New server‎‎ (5 changes | history) . . (+718). . [Yar‎ (5×)]

     

16:32

(cur | prev) . . (+26). . Yar (talk | contribs) (private wikis link)

     

16:23

(cur | prev) . . (+157). . Yar (talk | contribs) (check spam folder)

     

14:35

(cur | prev) . . (-17). . Yar (talk | contribs) (idk when searches will work)

     

14:34

(cur | prev) . . (+267). . Yar (talk | contribs) (rearrange, more info on passwords & emails)

     

14:27

(cur | prev) . . (+285). . Yar (talk | contribs) (confirm emails)

     14:28  Main Page‎ (diff | hist) . . (+75). . Yar (talk | contribs) (confirm email)

     14:09 

(User creation log). .

[Yar‎ (2×)]

     

14:09

. . User account Abhilash (talk | contribs) was created by Yar (talk | contribs) and password was sent by email ‎

     

14:09

. . User account Jrajbhandary (talk | contribs) was created by Yar (talk | contribs) and password was sent by email ‎

     12:14 

(Upload log). .

[Trevor S. Heaton‎; Anshul Krishnan‎ (2×); Vinh T. Le‎ (3×)]

     

12:14

. . Vinh T. Le (talk | contribs) uploaded File:ZOLA9252017 3.PNG

     

12:14

. . Vinh T. Le (talk | contribs) uploaded File:ZOLA9252017 2.PNG

     

12:13

. . Vinh T. Le (talk | contribs) uploaded File:ZOLA9252017 1.PNG

     

09:18

. . Trevor S. Heaton (talk | contribs) uploaded a new version of File:Graph 1.PNG

     

06:18

. . Anshul Krishnan (talk | contribs) uploaded File:BME100TempVTrials.png

     

06:10

. . Anshul Krishnan (talk | contribs) uploaded File:BME100L3Temp.png

24 September 2017

N    22:33  MediaWiki:Tagline‎ (diff | hist) . . (+16). . Yar (talk | contribs) (less parsing)
N    22:32  MediaWiki:Pagetitle-view-mainpage‎ (diff | hist) . . (+11). . Yar (talk | contribs) (less parsing)
N    22:32  MediaWiki:Opensearch-desc‎ (diff | hist) . . (+16). . Yar (talk | contribs) (english-only?)
N    21:21  MediaWiki:Pagetitle‎ (diff | hist) . . (+16). . Yar (talk | contribs) (idk if this will help or hurt)
N    21:18  MediaWiki:Aboutsite‎ (diff | hist) . . (+17). . Yar (talk | contribs) (one less thing to parse)