Difference between revisions of "840:153g:Projects/project24"

From OpenWetWare
Jump to: navigation, search
(20 intermediate revisions by 3 users not shown)
Line 1: Line 1:
<nowiki>Insert non-formatted text here</nowiki>{|{{table}} width="800"
+
{|{{table}} width="800"
|-<nowiki><nowiki>Insert non-formatted text here</nowiki></nowiki>
+
|-
 
|style="background-color: #cdde95;" align="center"|
 
|style="background-color: #cdde95;" align="center"|
 
<!-- ## START calendar column -->
 
<!-- ## START calendar column -->
Line 20: Line 20:
 
* Source Organism:'' E. coli'' 0157:H7
 
* Source Organism:'' E. coli'' 0157:H7
  
'''PROJECT DESCRIPTION'''
+
=='''Project Description'''==
 
Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids.   
 
Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids.   
  
 
+
=='''Overview'''==
 
*'''Source:''' Biology department of University of Northern Iowa
 
*'''Source:''' Biology department of University of Northern Iowa
 
*'''Media:''' Luria Broth
 
*'''Media:''' Luria Broth
Line 33: Line 33:
 
*'''Promoter used''':Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc
 
*'''Promoter used''':Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc
  
'''Alternative Promoters:'''
+
==Alternative Promoters:==
 
*'''BBa-K206000(PBad)''': is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC.
 
*'''BBa-K206000(PBad)''': is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC.
 
*'''J23109:RFP-106''' tttacagctagctcagtcctagggactgtgctagc (is medium promoter)
 
*'''J23109:RFP-106''' tttacagctagctcagtcctagggactgtgctagc (is medium promoter)
  
'''PCR primers for accC gene'''
+
=='''PCR primers for accC gene'''==
  
 
*• 24F_Biofuel1P      --  5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’
 
*• 24F_Biofuel1P      --  5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’
Line 45: Line 45:
 
*• 24RP_Biofuel2    --  5’ cgagttttttctccagatagtggatgttagtgc3’
 
*• 24RP_Biofuel2    --  5’ cgagttttttctccagatagtggatgttagtgc3’
  
• [['''Steps for project:''']]
+
=='''Steps for project'''==
 
*• Grow the  source organism (E. coli)
 
*• Grow the  source organism (E. coli)
 
*• DNA extraction from the source (E. coli)
 
*• DNA extraction from the source (E. coli)
Line 62: Line 62:
  
 
    
 
    
'''References:
+
=='''References'''==
 
*• Magnuson, K.,  Jackowski, S.,  Rock, C.O., and Cronan,  J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli.  Microbial Rev.57(3):522
 
*• Magnuson, K.,  Jackowski, S.,  Rock, C.O., and Cronan,  J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli.  Microbial Rev.57(3):522
 +
*http://mmbr.asm.org/content/57/3/522.full.pdf+html
 
*• Noemie,  M.  D.,  Parisien,  A.,  Wang, B., Lan, C.,  ( 2009). Enhancement of lipid production using biochemical, genetic and  transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41
 
*• Noemie,  M.  D.,  Parisien,  A.,  Wang, B., Lan, C.,  ( 2009). Enhancement of lipid production using biochemical, genetic and  transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41
* Siaut,  M.,  Cuine, S., Cagnon, C., Fessler, B., Nguyen, M., Carrier, P., Bryly, A., Beisson, F., Triantaphylides, C., Beisson, L., and Peltier, G., (2011). Oil Accumulation in the model green algae Chlamydomonas reinhardetii: characterization, variability between common laboratory strains and relationship with starch reserves. BMC Biotechnol 2011: 117
+
*http://www.sciencedirect.com/science/article/pii/S0168165609000959
*http://partsregistry.org/Main_Page
+
*• Siaut,  M.,  Cuine, S., Cagnon, C., Fessler, B., Nguyen, M., Carrier, P., Bryly, A., Beisson, F., Triantaphylides, C., Beisson, L., and Peltier, G., (2011). Oil Accumulation in the model green algae Chlamydomonas reinhardetii: characterization, variability between common laboratory strains and relationship with starch reserves. BMC Biotechnol 2011: 117
*• http://www.ncbi.nlm.nih.gov/
+
*http://www.biomedcentral.com/1472-6750/11/7
*• http://scholar.google.com/
+
 
 +
==''''''Presentation'''''':==
  
Presentation:
+
*Fuel_it_up_FINAL_Slide_Copy_PROJECT PROPOSAL .pptx (file) <br>
 +
*http://openwetware.org/images/4/42/Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx   
  
Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx (file) <br>
+
*Fuel it up Final Project presentation
http://openwetware.org/images/4/42/Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx                                              
+
* http://openwetware.org/wiki/Image:Group_25_final_presentation.pptx                                        
 
   
 
   
 
==Important Results and Milestones==
 
==Important Results and Milestones==

Revision as of 17:18, 6 December 2012

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext">09/11/2012,09/17/2012,09/20/2012,09/27/2012,10/04/2012,10/11/2012,10/16/2012,10/18/2012,10/22/2012,10/25/2012,11/01/2012,11/08/2012,11/15/2012</div><div style="display:none;" id="page">840:153g:Projects/project24</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html>

Team Members

  • Sanju Timilsina
  • Parul Sirohi

Over expression of E. coli Acetyl- CoA carboxylase (ACC)sub-unit accC in E.coli to enhance fatty acid accumulation for Bio-fuel production”.

  • Source Organism: E. coli 0157:H7

Project Description

Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids.

Overview

  • Source: Biology department of University of Northern Iowa
  • Media: Luria Broth
  • Gene: Acetyl CoA carboxylase biotin carboxylase (accC)
  • Accession no.: NC_011353.1 Region: 4242644..4243993 total base pair- 1350
  • Introns: None because Bacteria does not have any introns.
  • Bio-brick Compatibility: Compatible
  • Plasmid used: Vector Plasmid pSB1A3
  • Promoter used:Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc

Alternative Promoters:

  • BBa-K206000(PBad): is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC.
  • J23109:RFP-106 tttacagctagctcagtcctagggactgtgctagc (is medium promoter)

PCR primers for accC gene

  • • 24F_Biofuel1P -- 5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’
  • • 24RP_Biofuel2S -- 5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’
  • • 24F_Biofuel1 -- 5’ atgctggataaaattgttattgccaaccgc 3’
  • • 24RP_Biofuel2 -- 5’ cgagttttttctccagatagtggatgttagtgc3’

Steps for project

  • • Grow the source organism (E. coli)
  • • DNA extraction from the source (E. coli)
  • • Electrophoresis to check desired DNA segment (bp)
  • • Primer designing
  • • Multiplication of gene of interest by PCR
  • • Electrophorosis
  • • Digestion of Plasmid and gene by restriction enzymes
  • • Ligation of accC gene in plasmid vector (pSB1A3)
  • • Transformation of vector plasmid into host organism E. coli
  • • Cloning of cells in a LB media
  • • Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin)
  • • Inoculation of E.coli in biomass
  • • Testing of protein Acetyl CoA carboxylase biotin carboxylage by SDS-PAGE and fatty acid by thin layer chromatography


References

  • • Magnuson, K., Jackowski, S., Rock, C.O., and Cronan, J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli. Microbial Rev.57(3):522
  • http://mmbr.asm.org/content/57/3/522.full.pdf+html
  • • Noemie, M. D., Parisien, A., Wang, B., Lan, C., ( 2009). Enhancement of lipid production using biochemical, genetic and transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41
  • http://www.sciencedirect.com/science/article/pii/S0168165609000959
  • • Siaut, M., Cuine, S., Cagnon, C., Fessler, B., Nguyen, M., Carrier, P., Bryly, A., Beisson, F., Triantaphylides, C., Beisson, L., and Peltier, G., (2011). Oil Accumulation in the model green algae Chlamydomonas reinhardetii: characterization, variability between common laboratory strains and relationship with starch reserves. BMC Biotechnol 2011: 117
  • http://www.biomedcentral.com/1472-6750/11/7

'Presentation':

Important Results and Milestones

  • keep track of your most important results and refer to the corresponding page in your notebook
  • upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).
Recent changes

26 September 2017

N    09:45  CTR:Notebook/Migrant/2017/09/12‎ (diff | hist) . . (+950). . Vinh T. Le (talk | contribs) (Autocreate 2017/09/12 Entry for CTR:Notebook/Migrant)
 m   09:35  Li Lab:People‎ (diff | hist) . . (+1). . Wei Li Bcm (talk | contribs)

     09:21 

(User creation log). .

[Yar‎ (3×)]

     

09:21

. . User account Calacalu (talk | contribs) was created by Yar (talk | contribs) and password was sent by email ‎

     

09:21

. . User account Wagroves (talk | contribs) was created by Yar (talk | contribs) and password was sent by email ‎

     

09:03

. . User account Merman (talk | contribs) was created by Yar (talk | contribs) and password was sent by email ‎

N    09:13 

User:Merman‎‎ (2 changes | history) . . (+32). . [Merman‎ (2×)]

     

09:13

(cur | prev) . . (+23). . Merman (talk | contribs) (test link)

N    

09:09

(cur | prev) . . (+9). . Merman (talk | contribs) (testing no captcha)

     08:42 

Hoatlin:BMB seminar series 2017-2018‎‎ (2 changes | history) . . (+24). . [Maureen E. Hoatlin‎ (2×)]

     

08:42

(cur | prev) . . (-75). . Maureen E. Hoatlin (talk | contribs) (Seminar Schedule 2017-2018)

     

08:41

(cur | prev) . . (+99). . Maureen E. Hoatlin (talk | contribs) (Seminar Schedule 2017-2018)

     07:32 

Tomlinson:News‎‎ (2 changes | history) . . (+83). . [Ryan E. Tomlinson‎ (2×)]

     

07:32

(cur | prev) . . (+11). . Ryan E. Tomlinson (talk | contribs) (2017)

     

07:32

(cur | prev) . . (+72). . Ryan E. Tomlinson (talk | contribs)

     07:30 

Tomlinson:Lab Members‎‎ (3 changes | history) . . (+46). . [Ryan E. Tomlinson‎ (3×)]

     

07:30

(cur | prev) . . (+4). . Ryan E. Tomlinson (talk | contribs) (Kimberly Huang)

     

07:30

(cur | prev) . . (+4). . Ryan E. Tomlinson (talk | contribs) (Emily Rumpf)

     

07:30

(cur | prev) . . (+38). . Ryan E. Tomlinson (talk | contribs)

     07:11 (Move log) . . Karmella Haynes (talk | contribs) moved page BME100 f2017:Group6 W1030 L6 to BME100 f2017:Group6 W1030 L6 delete this page(Class assignment. Students did not follow instructions for generating a page with correct formatting. Freeing up the page title to allow students to re-generate the correct page.)
     07:07  BME100 f2017:Projects6‎ (diff | hist) . . (+19). . Karmella Haynes (talk | contribs)
     07:07  BME100 f2017:Projects5‎ (diff | hist) . . (+19). . Karmella Haynes (talk | contribs)
     07:07  BME100 f2017:Projects4‎ (diff | hist) . . (+19). . Karmella Haynes (talk | contribs)
     07:01  BME100 f2017:Projects3‎ (diff | hist) . . (+19). . Karmella Haynes (talk | contribs)
     06:59  BME100 f2017:Projects2‎ (diff | hist) . . (+19). . Karmella Haynes (talk | contribs)

     04:06 

Butlin:Unix for Bioinformatics - advanced tutorial‎‎ (3 changes | history) . . (+334). . [Claudius E Kerth‎ (3×)]

     

04:06

(cur | prev) . . (+148). . Claudius E Kerth (talk | contribs) (Added troublehooting tip: when rename.pl download link does not work, go to my Dropbox)

     

02:44

(cur | prev) . . (+168). . Claudius E Kerth (talk | contribs) (added Troubleshooting tip)

 m   

02:36

(cur | prev) . . (+18). . Claudius E Kerth (talk | contribs) (TASK 5: I have split my reads by barcode and I have quality filtered them. Now I want to know how many reads I have left from each (barcoded) individual. How can I find that out?)

25 September 2017

     21:19 

BME100 f2017:Group12 W0800 L3‎‎ (12 changes | history) . . (+3,361). . [Priscilla Y. Han‎ (12×)]

     

21:19

(cur | prev) . . (+25). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

21:15

(cur | prev) . . (+70). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

21:11

(cur | prev) . . (-3). . Priscilla Y. Han (talk | contribs) (Experimental Design of Device)

     

21:10

(cur | prev) . . (-12). . Priscilla Y. Han (talk | contribs) (Experimental Design of Device)

     

21:10

(cur | prev) . . (+15). . Priscilla Y. Han (talk | contribs) (Experimental Design of Device)

     

21:09

(cur | prev) . . (+3,181). . Priscilla Y. Han (talk | contribs) (Experimental Design of Device)

     

21:05

(cur | prev) . . (+5). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

21:03

(cur | prev) . . (+25). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

21:01

(cur | prev) . . (+2). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

20:58

(cur | prev) . . (+29). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

20:57

(cur | prev) . . (-3). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

20:55

(cur | prev) . . (+27). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     21:19 

(Upload log). .

[Priscilla Y. Han‎ (7×)]

     

21:19

. . Priscilla Y. Han (talk | contribs) uploaded File:Pulsingbargraph12.png

     

21:18

. . Priscilla Y. Han (talk | contribs) uploaded File:Mypear sonheart12.png

     

21:18

. . Priscilla Y. Han (talk | contribs) uploaded File:Heartratespree12.png

     

21:04

. . Priscilla Y. Han (talk | contribs) uploaded File:Scrnshotspree12.png

     

20:59

. . Priscilla Y. Han (talk | contribs) uploaded File:2columnbarsspree.png

     

20:56

. . Priscilla Y. Han (talk | contribs) uploaded a new version of File:Mypear sonr.png

     

20:56

. . Priscilla Y. Han (talk | contribs) uploaded File:Mypear sonr.png

     20:33 

BME100 f2017:Group8 W1030 L3‎‎ (8 changes | history) . . (+314). . [Jennifer L. Brodsky‎ (8×)]

     

20:33

(cur | prev) . . (+5). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:32

(cur | prev) . . (+112). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:29

(cur | prev) . . (0). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:28

(cur | prev) . . (+13). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:28

(cur | prev) . . (-1). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:26

(cur | prev) . . (+1). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:26

(cur | prev) . . (+177). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:25

(cur | prev) . . (+7). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)