Difference between revisions of "840:153g:Projects/project24"

From OpenWetWare
Jump to: navigation, search
m
(33 intermediate revisions by 3 users not shown)
Line 1: Line 1:
<nowiki>Insert non-formatted text here</nowiki>{|{{table}} width="800"
+
{|{{table}} width="800"
|-<nowiki><nowiki>Insert non-formatted text here</nowiki></nowiki>
+
|-
 
|style="background-color: #cdde95;" align="center"|
 
|style="background-color: #cdde95;" align="center"|
 
<!-- ## START calendar column -->
 
<!-- ## START calendar column -->
Line 20: Line 20:
 
* Source Organism:'' E. coli'' 0157:H7
 
* Source Organism:'' E. coli'' 0157:H7
  
'''PROJECT DESCRIPTION'''
+
=='''Project Description'''==
 
Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids.   
 
Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids.   
  
 +
=='''Overview'''==
 +
*'''Source:''' Biology department of University of Northern Iowa
 +
*'''Media:''' Luria Broth
 +
*'''Gene:''' Acetyl CoA carboxylase biotin carboxylase (accC)
 +
*'''Accession no.:''' NC_011353.1 Region: 4242644..4243993 total base pair- 1350
 +
*'''Introns''': None because Bacteria does not have any introns.
 +
*'''Bio-brick Compatibility:''' Compatible
 +
*'''Plasmid used''': Vector Plasmid pSB1A3
 +
*'''Promoter used''':Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc
  
 +
==Alternative Promoters:==
 +
*'''BBa-K206000(PBad)''': is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC.
 +
*'''J23109:RFP-106''' tttacagctagctcagtcctagggactgtgctagc (is medium promoter)
  
*Source: Biology department of University of Northern Iowa
+
=='''PCR primers for accC gene'''==
  
*Media: Luria Broth
+
*• 24F_Biofuel1P      --  5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’
 +
*• 24RP_Biofuel2S  --  5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’
  
 +
*• 24F_Biofuel1      --  5’ atgctggataaaattgttattgccaaccgc 3’
 +
*• 24RP_Biofuel2    --  5’ cgagttttttctccagatagtggatgttagtgc3’
  
#Gene: Acetyl CoA carboxylase biotin carboxylase (accC)
+
=='''Steps for project'''==
 
+
*• Grow the  source organism (E. coli)
 
+
*• DNA extraction from the source (E. coli)
#Accession no.: NC_011353.1 Region: 4242644..4243993 total base pair- 1350
+
*• Electrophoresis to check desired DNA segment (bp)  
 
+
*• Primer designing  
 
+
*• Multiplication of  gene of interest by PCR
'''Introns''': None because Bacteria does not have any introns.
+
*• Electrophorosis
 
+
*• Digestion of Plasmid and gene by restriction enzymes
 
+
*• Ligation of accC gene in plasmid vector (pSB1A3)
'''Bio-brick Compatibility:''' Compatible
+
*• Transformation of vector plasmid  into host organism E. coli
 
+
*• Cloning of cells in a LB media
 
+
*• Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin)
'''Plasmid used''': Vector Plasmid pSB1A3
+
*• Inoculation of E.coli in biomass
 
+
*• Testing of protein Acetyl CoA carboxylase biotin carboxylage by SDS-PAGE and fatty acid  by thin layer chromatography
 
 
'''Promoter used''':Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc
 
 
 
 
 
 
 
'''Alternative Promoters:'''
 
BBa-K206000(PBad): is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC.
 
 
 
 
 
J23109:RFP-106 tttacagctagctcagtcctagggactgtgctagc (is medium promoter)
 
 
 
 
 
'''PCR primers for accC gene'''
 
 
 
• 24F_Biofuel1P  5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’
 
 
 
                             
 
• 24RP_Biofuel2S  5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’
 
 
 
 
 
 
 
• 24F_Biofuel1    5’ atgctggataaaattgttattgccaaccgc 3’
 
 
 
 
 
 
 
• 24RP_Biofuel2  5’ cgagttttttctccagatagtggatgttagtgc3’
 
 
 
 
 
• [['''Steps for project:''']]
 
 
 
 
 
• Grow the  source organism (E. coli)
 
 
 
 
 
• DNA extraction from the source (E. coli)
 
 
 
 
 
• Electrophoresis to check desired DNA segment (bp)  
 
 
 
 
 
• Primer designing  
 
 
 
 
 
• Multiplication of  gene of interest by PCR
 
 
 
 
 
• Electrophorosis
 
 
 
 
 
• Digestion of Plasmid and gene by restriction enzymes
 
 
 
 
 
• Ligation of accC gene in plasmid vector (pSB1A3)
 
 
 
 
 
• Transformation of vector plasmid  into host organism E. coli
 
 
 
 
 
• Cloning of cells in a LB media
 
 
 
 
 
• Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin)
 
 
 
 
 
• Inoculation of E.coli in biomass
 
 
 
 
 
• Testing of protein Acetyl CoA carboxylase biotin carboxylage by SDS-PAGE and fatty acid  by thin layer chromatography
 
  
  
 
    
 
    
'''References:
+
=='''References'''==
 
+
*• Magnuson, K.,  Jackowski, S.,  Rock, C.O., and Cronan,  J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli.  Microbial Rev.57(3):522
 
+
*http://mmbr.asm.org/content/57/3/522.full.pdf+html
• Magnuson, K.,  Jackowski, S.,  Rock, C.O., and Cronan,  J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli.  Microbial Rev.57(3):522
+
*• Noemie,  M.  D.,  Parisien,  A.,  Wang, B., Lan, C.,  ( 2009). Enhancement of lipid production using biochemical, genetic and  transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41
 
+
*http://www.sciencedirect.com/science/article/pii/S0168165609000959
 
+
*• Siaut,  M.,  Cuine, S., Cagnon, C., Fessler, B., Nguyen, M., Carrier, P., Bryly, A., Beisson, F., Triantaphylides, C., Beisson, L., and Peltier, G., (2011). Oil Accumulation in the model green algae Chlamydomonas reinhardetii: characterization, variability between common laboratory strains and relationship with starch reserves. BMC Biotechnol 2011: 117
• Noemie,  M.  D.,  Parisien,  A.,  Wang, B., Lan, C.,  ( 2009). Enhancement of lipid production using biochemical, genetic and  transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41
+
*http://www.biomedcentral.com/1472-6750/11/7
 
 
 
 
 
 
http://partsregistry.org/Main_Page
 
 
 
 
 
http://www.ncbi.nlm.nih.gov/
 
 
 
  
• http://scholar.google.com/
+
==''''''Presentation'''''':==
  
Presentation:
+
*Fuel_it_up_FINAL_Slide_Copy_PROJECT PROPOSAL .pptx (file) <br>
 +
*http://openwetware.org/images/4/42/Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx   
  
Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx (file)
+
*Fuel it up Final Project presentation
                                             
+
* http://openwetware.org/wiki/Image:Group_25_final_presentation.pptx                                        
 
   
 
   
 
==Important Results and Milestones==
 
==Important Results and Milestones==

Revision as of 17:18, 6 December 2012

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext">09/11/2012,09/17/2012,09/20/2012,09/27/2012,10/04/2012,10/11/2012,10/16/2012,10/18/2012,10/22/2012,10/25/2012,11/01/2012,11/08/2012,11/15/2012</div><div style="display:none;" id="page">840:153g:Projects/project24</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html>

Team Members

  • Sanju Timilsina
  • Parul Sirohi

Over expression of E. coli Acetyl- CoA carboxylase (ACC)sub-unit accC in E.coli to enhance fatty acid accumulation for Bio-fuel production”.

  • Source Organism: E. coli 0157:H7

Project Description

Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids.

Overview

  • Source: Biology department of University of Northern Iowa
  • Media: Luria Broth
  • Gene: Acetyl CoA carboxylase biotin carboxylase (accC)
  • Accession no.: NC_011353.1 Region: 4242644..4243993 total base pair- 1350
  • Introns: None because Bacteria does not have any introns.
  • Bio-brick Compatibility: Compatible
  • Plasmid used: Vector Plasmid pSB1A3
  • Promoter used:Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc

Alternative Promoters:

  • BBa-K206000(PBad): is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC.
  • J23109:RFP-106 tttacagctagctcagtcctagggactgtgctagc (is medium promoter)

PCR primers for accC gene

  • • 24F_Biofuel1P -- 5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’
  • • 24RP_Biofuel2S -- 5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’
  • • 24F_Biofuel1 -- 5’ atgctggataaaattgttattgccaaccgc 3’
  • • 24RP_Biofuel2 -- 5’ cgagttttttctccagatagtggatgttagtgc3’

Steps for project

  • • Grow the source organism (E. coli)
  • • DNA extraction from the source (E. coli)
  • • Electrophoresis to check desired DNA segment (bp)
  • • Primer designing
  • • Multiplication of gene of interest by PCR
  • • Electrophorosis
  • • Digestion of Plasmid and gene by restriction enzymes
  • • Ligation of accC gene in plasmid vector (pSB1A3)
  • • Transformation of vector plasmid into host organism E. coli
  • • Cloning of cells in a LB media
  • • Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin)
  • • Inoculation of E.coli in biomass
  • • Testing of protein Acetyl CoA carboxylase biotin carboxylage by SDS-PAGE and fatty acid by thin layer chromatography


References

  • • Magnuson, K., Jackowski, S., Rock, C.O., and Cronan, J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli. Microbial Rev.57(3):522
  • http://mmbr.asm.org/content/57/3/522.full.pdf+html
  • • Noemie, M. D., Parisien, A., Wang, B., Lan, C., ( 2009). Enhancement of lipid production using biochemical, genetic and transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41
  • http://www.sciencedirect.com/science/article/pii/S0168165609000959
  • • Siaut, M., Cuine, S., Cagnon, C., Fessler, B., Nguyen, M., Carrier, P., Bryly, A., Beisson, F., Triantaphylides, C., Beisson, L., and Peltier, G., (2011). Oil Accumulation in the model green algae Chlamydomonas reinhardetii: characterization, variability between common laboratory strains and relationship with starch reserves. BMC Biotechnol 2011: 117
  • http://www.biomedcentral.com/1472-6750/11/7

'Presentation':

Important Results and Milestones

  • keep track of your most important results and refer to the corresponding page in your notebook
  • upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).
Recent changes

18 October 2017

     09:42 

(Upload log). .

[Trevor S. Heaton‎; Sayyed Ourmazd Mohseni‎; Kennedy Miskin‎; Carlos Mendez-Arias‎; Benjamin J. Pitts‎; Alexandra Richey‎; John Navas‎ (2×); Caiden Joseph Gledhill‎ (7×)]

     

09:42

. . Alexandra Richey (talk | contribs) uploaded File:AER PCR.jpeg

     

09:42

. . Trevor S. Heaton (talk | contribs) uploaded File:IMG 6508.JPG

     

09:41

. . Sayyed Ourmazd Mohseni (talk | contribs) uploaded File:Rick0.png

     

09:40

. . Caiden Joseph Gledhill (talk | contribs) uploaded File:Lego scientist 2.jpg

     

09:40

. . Carlos Mendez-Arias (talk | contribs) uploaded File:Carlosamendezarias.jpg

     

09:40

. . John Navas (talk | contribs) uploaded File:BME100WG15 SR PCRsetup.jpg

     

09:39

. . Kennedy Miskin (talk | contribs) uploaded File:KennedyMiskinProfilePic.jpg

     

09:38

. . Benjamin J. Pitts (talk | contribs) uploaded File:Shaquille-oneal-1.jpg

     

09:36

. . John Navas (talk | contribs) uploaded File:BME100WG15 CM PCRsetup.jpg

     

09:34

. . Caiden Joseph Gledhill (talk | contribs) uploaded a new version of File:Lego scientist 6.jpg

     

09:34

. . Caiden Joseph Gledhill (talk | contribs) uploaded a new version of File:Lego scientist 6.jpg

     

09:34

. . Caiden Joseph Gledhill (talk | contribs) uploaded a new version of File:Lego scientist 6.jpg

     

09:34

. . Caiden Joseph Gledhill (talk | contribs) uploaded a new version of File:Lego scientist 6.jpg

     

09:34

. . Caiden Joseph Gledhill (talk | contribs) uploaded a new version of File:Lego scientist 6.jpg

     

09:34

. . Caiden Joseph Gledhill (talk | contribs) uploaded a new version of File:Lego scientist 6.jpg

     09:42 

BME100 f2017:Group6 W0800 L4‎‎ (2 changes | history) . . (+1,664). . [Timothy J. Oetter‎; Tajinder Uppal‎]

     

09:42

(cur | prev) . . (+1,000). . Tajinder Uppal (talk | contribs) (Research and Development)

     

09:34

(cur | prev) . . (+664). . Timothy J. Oetter (talk | contribs) (SNP Information & Primer Design)

     09:42  BME100 f2017:Group7 W0800 L4‎ (diff | hist) . . (-8). . Sayyed Ourmazd Mohseni (talk | contribs) (OUR TEAM)

     09:41 

BME100 f2017:Group14 W0800 L4‎‎ (13 changes | history) . . (-359). . [Carlos Mendez-Arias‎; Shae M. Diaz‎ (3×); Kennedy Miskin‎ (4×); David Leonard E. Asuncion‎ (5×)]

     

09:41

(cur | prev) . . (+38). . David Leonard E. Asuncion (talk | contribs) (Protocol)

     

09:41

(cur | prev) . . (-269). . Kennedy Miskin (talk | contribs) (Research & Development)

     

09:41

(cur | prev) . . (+62). . Shae M. Diaz (talk | contribs) (Protocol)

     

09:40

(cur | prev) . . (-26). . David Leonard E. Asuncion (talk | contribs) (Protocol)

     

09:39

(cur | prev) . . (+2). . Shae M. Diaz (talk | contribs) (Protocol)

     

09:39

(cur | prev) . . (+5). . Carlos Mendez-Arias (talk | contribs) (TEAM MEMBERS)

     

09:38

(cur | prev) . . (+115). . Shae M. Diaz (talk | contribs) (Citations)

     

09:38

(cur | prev) . . (-1). . Kennedy Miskin (talk | contribs) (TEAM MEMBERS)

     

09:37

(cur | prev) . . (+67). . David Leonard E. Asuncion (talk | contribs) (Protocol)

     

09:37

(cur | prev) . . (+5). . Kennedy Miskin (talk | contribs) (TEAM MEMBERS)

     

09:36

(cur | prev) . . (+5). . Kennedy Miskin (talk | contribs) (TEAM MEMBERS)

     

09:36

(cur | prev) . . (+390). . David Leonard E. Asuncion (talk | contribs) (Protocol)

     

09:35

(cur | prev) . . (-752). . David Leonard E. Asuncion (talk | contribs) (Protocol)

     09:41 

BME100 f2017:Group1 W0800 L4‎‎ (2 changes | history) . . (+26). . [Caiden Joseph Gledhill‎; Alexandra Richey‎]

     

09:41

(cur | prev) . . (+23). . Alexandra Richey (talk | contribs) (Research and Development)

     

09:39

(cur | prev) . . (+3). . Caiden Joseph Gledhill (talk | contribs) (OUR TEAM)

     09:41 

BME100 f2017:Group15 W0800 L4‎‎ (4 changes | history) . . (+469). . [Samuel J. Ramirez‎ (2×); John Navas‎ (2×)]

     

09:41

(cur | prev) . . (+9). . John Navas (talk | contribs) (OUR TEAM)

     

09:40

(cur | prev) . . (+66). . Samuel J. Ramirez (talk | contribs) (Part 1: Use the NCBI database to find a disease-associated sequence)

     

09:39

(cur | prev) . . (+385). . Samuel J. Ramirez (talk | contribs) (Part 1: Use the NCBI database to find a disease-associated sequence)

     

09:37

(cur | prev) . . (+9). . John Navas (talk | contribs) (OUR TEAM)

N    09:40 

BME100 f2017:Group5 W0800 L4‎‎ (2 changes | history) . . (+5,152). . [Anna Hoge‎ (2×)]

     

09:40

(cur | prev) . . (+500). . Anna Hoge (talk | contribs) (Protocol)

N    

09:39

(cur | prev) . . (+4,652). . Anna Hoge (talk | contribs) (Created page with "{|{{table}} width="800" |- |style="background-color: #EEE"|128px<span style="font-size:22px;"> BME 100 Fall 2017</span> |style="background-color...")

     09:39  BME100 f2017:Group13 W0800 L4‎ (diff | hist) . . (+4). . Benjamin J. Pitts (talk | contribs) (OUR TEAM)
     09:38  BME100 f2017:Group3 W0800 L4‎ (diff | hist) . . (+861). . Joseph M. Green (talk | contribs) (Research and Development)

     09:38 

BME100 f2017:Group9 W0800 L4‎‎ (3 changes | history) . . (+1,057). . [Erik Sandoval-Ansel‎; Renee Chao‎ (2×)]

     

09:38

(cur | prev) . . (+5). . Renee Chao (talk | contribs) (SNP Information & Primer Design)

     

09:37

(cur | prev) . . (+258). . Renee Chao (talk | contribs) (SNP Information & Primer Design)

     

09:36

(cur | prev) . . (+794). . Erik Sandoval-Ansel (talk | contribs) (Research and Development)

     09:37  User:Mauro Robles‎ (diff | hist) . . (-25). . Mauro Robles (talk | contribs)

     09:37 

BME100 f2017:Group7 W1030 L4‎‎ (3 changes | history) . . (+567). . [Sarah R. Brady‎ (3×)]

     

09:37

(cur | prev) . . (-9). . Sarah R. Brady (talk | contribs) (LAB 4 WRITE-UP)

     

09:36

(cur | prev) . . (-4). . Sarah R. Brady (talk | contribs) (Protocol)

     

09:35

(cur | prev) . . (+580). . Sarah R. Brady (talk | contribs) (Protocol)

     09:35 

User:Frida Kaellgren‎‎ (2 changes | history) . . (-61). . [Frida Kaellgren‎ (2×)]

     

09:35

(cur | prev) . . (-29). . Frida Kaellgren (talk | contribs)

     

09:34

(cur | prev) . . (-32). . Frida Kaellgren (talk | contribs)