Difference between revisions of "840:153g:Projects/project24"

From OpenWetWare
Jump to: navigation, search
m
(36 intermediate revisions by 2 users not shown)
Line 1: Line 1:
<nowiki>Insert non-formatted text here</nowiki>{|{{table}} width="800"
+
{|{{table}} width="800"
|-<nowiki><nowiki>Insert non-formatted text here</nowiki></nowiki>
+
|-
 
|style="background-color: #cdde95;" align="center"|
 
|style="background-color: #cdde95;" align="center"|
 
<!-- ## START calendar column -->
 
<!-- ## START calendar column -->
Line 18: Line 18:
  
 
==Over expression of ''E. coli'' Acetyl- CoA carboxylase (ACC)sub-unit accC in ''E.coli'' to enhance fatty acid accumulation for Bio-fuel production”.==
 
==Over expression of ''E. coli'' Acetyl- CoA carboxylase (ACC)sub-unit accC in ''E.coli'' to enhance fatty acid accumulation for Bio-fuel production”.==
* Source Organism:'' E. coli'' 0157:H7�
+
* Source Organism:'' E. coli'' 0157:H7
'''PROJECT DESCRIPTION'''
 
Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis. TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids. 
 
  
'''Source:''' Biology department of University of Northern Iowa�
+
=='''Project Description'''==
'''Media:''' Luria Broth�
+
Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids.  
'''Gene:''' Acetyl CoA carboxylase biotin carboxylase (accC)
 
'''Accession #:''' NC_011353.1 Region: 4242644..4243993 total base pair- 1350�
 
'''Introns''': None because Bacteria does not have any introns.
 
'''Bio-brick Compatibility:''' Compatible
 
'''Plasmid used''': Vector Plasmid pSB1A3
 
'''Promoter used''':Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc
 
 
 
'''Alternative Promoters:'''
 
BBa-K206000(PBad): is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC.
 
J23109:RFP-106 tttacagctagctcagtcctagggactgtgctagc (is medium promoter)
 
  
'''PCR primers for accC gene'''
+
=='''Overview'''==
 +
*'''Source:''' Biology department of University of Northern Iowa
 +
*'''Media:''' Luria Broth
 +
*'''Gene:''' Acetyl CoA carboxylase biotin carboxylase (accC)
 +
*'''Accession no.:''' NC_011353.1 Region: 4242644..4243993 total base pair- 1350
 +
*'''Introns''': None because Bacteria does not have any introns.
 +
*'''Bio-brick Compatibility:''' Compatible
 +
*'''Plasmid used''': Vector Plasmid pSB1A3
 +
*'''Promoter used''':Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc
  
• 24F_Biofuel1P  5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’
+
==Alternative Promoters:==
 +
*'''BBa-K206000(PBad)''': is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC.
 +
*'''J23109:RFP-106''' tttacagctagctcagtcctagggactgtgctagc (is medium promoter)
  
                             
+
=='''PCR primers for accC gene'''==
• 24RP_Biofuel2S  5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’
 
  
 +
*• 24F_Biofuel1P      --  5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’
 +
*• 24RP_Biofuel2S  --  5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’
  
 +
*• 24F_Biofuel1      --  5’ atgctggataaaattgttattgccaaccgc 3’
 +
*• 24RP_Biofuel2    --  5’ cgagttttttctccagatagtggatgttagtgc3’
  
24F_Biofuel1    5’ atgctggataaaattgttattgccaaccgc 3’
+
=='''Steps for project'''==
 +
*Grow the  source organism (E. coli)
 +
*• DNA extraction from the source (E. coli)
 +
*• Electrophoresis to check desired DNA segment (bp)
 +
*• Primer designing
 +
*• Multiplication of  gene of interest by PCR
 +
*• Electrophorosis
 +
*• Digestion of Plasmid and gene by restriction enzymes
 +
*• Ligation of accC gene in plasmid vector (pSB1A3)
 +
*• Transformation of vector plasmid  into host organism E. coli
 +
*• Cloning of cells in a LB media
 +
*• Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin)
 +
*• Inoculation of E.coli in biomass
 +
*• Testing of protein Acetyl CoA carboxylase biotin carboxylage by SDS-PAGE and fatty acid  by thin layer chromatography
  
  
 +
 
 +
=='''References'''==
 +
*• Magnuson, K.,  Jackowski, S.,  Rock, C.O., and Cronan,  J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli.  Microbial Rev.57(3):522
 +
*http://mmbr.asm.org/content/57/3/522.full.pdf+html
 +
*• Noemie,  M.  D.,  Parisien,  A.,  Wang, B., Lan, C.,  ( 2009). Enhancement of lipid production using biochemical, genetic and  transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41
 +
*http://www.sciencedirect.com/science/article/pii/S0168165609000959
 +
*• Siaut,  M.,  Cuine, S., Cagnon, C., Fessler, B., Nguyen, M., Carrier, P., Bryly, A., Beisson, F., Triantaphylides, C., Beisson, L., and Peltier, G., (2011). Oil Accumulation in the model green algae Chlamydomonas reinhardetii: characterization, variability between common laboratory strains and relationship with starch reserves. BMC Biotechnol 2011: 117
 +
*http://www.biomedcentral.com/1472-6750/11/7
  
• 24RP_Biofuel2  5’ cgagttttttctccagatagtggatgttagtgc3’
+
==''''''Presentation'''''':==
  
 
+
*Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx (file) <br>
• [['''Steps for project:''']]
+
*http://openwetware.org/images/4/42/Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx                                             
• Grow the  source organism (E. coli)
 
• DNA extraction from the source (E. coli)
 
• Electrophoresis to check desired DNA segment (bp)
 
• Primer designing
 
• Multiplication of  gene of interest by PCR
 
• Electrophorosis
 
• Digestion of Plasmid and gene by restriction enzymes
 
• Ligation of accC gene in plasmid vector (pSB1A3)
 
• Transformation of vector plasmid  into host organism E. coli
 
• Cloning of cells in a LB media
 
• Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin)
 
• Inoculation of E.coli in biomass
 
• Testing of protein Acetyl CoA carboxylase biotin carboxylage by SDS-PAGE and fatty acid  by thin layer chromatography
 
 
 
• '''Presentation''':Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx‎ (file size: 472 KB, MIME type: application/zip) 
 
• '''References:
 
• Magnuson, K.,  Jackowski, S.,  Rock, C.O., and Cronan,  J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli.  Microbial Rev.57(3):522
 
• Noemie,  M.  D.,  Parisien,  A.,  Wang, B., Lan, C.,  ( 2009). Enhancement of lipid production using biochemical, genetic and  transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41
 
 
 
http://partsregistry.org/Main_Page
 
• http://www.ncbi.nlm.nih.gov/
 
• http://scholar.google.com/
 
 
 
                                             
 
 
   
 
   
 
==Important Results and Milestones==
 
==Important Results and Milestones==

Revision as of 11:25, 18 September 2012

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext">09/11/2012,09/17/2012,09/20/2012,09/27/2012,10/04/2012,10/11/2012,10/16/2012,10/18/2012,10/22/2012,10/25/2012,11/01/2012,11/08/2012,11/15/2012</div><div style="display:none;" id="page">840:153g:Projects/project24</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html>

Team Members

  • Sanju Timilsina
  • Parul Sirohi

Over expression of E. coli Acetyl- CoA carboxylase (ACC)sub-unit accC in E.coli to enhance fatty acid accumulation for Bio-fuel production”.

  • Source Organism: E. coli 0157:H7

Project Description

Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids.

Overview

  • Source: Biology department of University of Northern Iowa
  • Media: Luria Broth
  • Gene: Acetyl CoA carboxylase biotin carboxylase (accC)
  • Accession no.: NC_011353.1 Region: 4242644..4243993 total base pair- 1350
  • Introns: None because Bacteria does not have any introns.
  • Bio-brick Compatibility: Compatible
  • Plasmid used: Vector Plasmid pSB1A3
  • Promoter used:Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc

Alternative Promoters:

  • BBa-K206000(PBad): is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC.
  • J23109:RFP-106 tttacagctagctcagtcctagggactgtgctagc (is medium promoter)

PCR primers for accC gene

  • • 24F_Biofuel1P -- 5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’
  • • 24RP_Biofuel2S -- 5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’
  • • 24F_Biofuel1 -- 5’ atgctggataaaattgttattgccaaccgc 3’
  • • 24RP_Biofuel2 -- 5’ cgagttttttctccagatagtggatgttagtgc3’

Steps for project

  • • Grow the source organism (E. coli)
  • • DNA extraction from the source (E. coli)
  • • Electrophoresis to check desired DNA segment (bp)
  • • Primer designing
  • • Multiplication of gene of interest by PCR
  • • Electrophorosis
  • • Digestion of Plasmid and gene by restriction enzymes
  • • Ligation of accC gene in plasmid vector (pSB1A3)
  • • Transformation of vector plasmid into host organism E. coli
  • • Cloning of cells in a LB media
  • • Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin)
  • • Inoculation of E.coli in biomass
  • • Testing of protein Acetyl CoA carboxylase biotin carboxylage by SDS-PAGE and fatty acid by thin layer chromatography


References

  • • Magnuson, K., Jackowski, S., Rock, C.O., and Cronan, J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli. Microbial Rev.57(3):522
  • http://mmbr.asm.org/content/57/3/522.full.pdf+html
  • • Noemie, M. D., Parisien, A., Wang, B., Lan, C., ( 2009). Enhancement of lipid production using biochemical, genetic and transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41
  • http://www.sciencedirect.com/science/article/pii/S0168165609000959
  • • Siaut, M., Cuine, S., Cagnon, C., Fessler, B., Nguyen, M., Carrier, P., Bryly, A., Beisson, F., Triantaphylides, C., Beisson, L., and Peltier, G., (2011). Oil Accumulation in the model green algae Chlamydomonas reinhardetii: characterization, variability between common laboratory strains and relationship with starch reserves. BMC Biotechnol 2011: 117
  • http://www.biomedcentral.com/1472-6750/11/7

'Presentation':

Important Results and Milestones

  • keep track of your most important results and refer to the corresponding page in your notebook
  • upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).
Recent changes

16 October 2017

     18:48 

Hoatlin:OHSU Genetic Mechanisms Class‎‎ (2 changes | history) . . (+12). . [Maureen E. Hoatlin‎ (2×)]

     

18:48

(cur | prev) . . (+7). . Maureen E. Hoatlin (talk | contribs) (Other Bonus Material)

     

18:47

(cur | prev) . . (+5). . Maureen E. Hoatlin (talk | contribs) (Other Bonus Material)

N    16:16 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/10/11‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

16:16

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (10/11 Lab Notebook)

N    

16:15

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/10/11 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

     16:15 

(Upload log). .

[Maryam Yamadi‎ (9×)]

     

16:15

. . Maryam Yamadi (talk | contribs) uploaded File:10 11.jpg

     

16:07

. . Maryam Yamadi (talk | contribs) uploaded File:10 10.jpg

     

15:12

. . Maryam Yamadi (talk | contribs) uploaded File:10 04.jpg

     

15:10

. . Maryam Yamadi (talk | contribs) uploaded File:10 03.jpg

     

15:05

. . Maryam Yamadi (talk | contribs) uploaded File:09 27.jpg

     

15:02

. . Maryam Yamadi (talk | contribs) uploaded File:09 26.jpg

     

14:59

. . Maryam Yamadi (talk | contribs) uploaded a new version of File:09 20.jpg(09/20 lab notebook)

     

14:58

. . Maryam Yamadi (talk | contribs) uploaded File:09 20.jpg(09/20 lab notebook)

     

14:55

. . Maryam Yamadi (talk | contribs) uploaded File:09 19.jpg(09_19 lab notebook)

N    16:08 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/10/10‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

16:08

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (10/10 Lab Notebook)

N    

16:06

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/10/10 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    15:20 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/10/04‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

15:20

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (10/04 Lab notebook)

N    

15:11

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/10/04 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    15:10 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/10/03‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

15:10

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (10/03 Lab Notebook)

N    

15:09

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/10/03 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    15:09  User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/10‎ (diff | hist) . . (+202). . Maryam Yamadi (talk | contribs) (Autocreate Month 2017/10 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    15:05 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/09/27‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

15:05

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (09/27 Lab Notebook)

N    

15:03

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/09/27 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    15:02 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/09/26‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

15:02

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (09/26 Lab notebook)

N    

15:00

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/09/26 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    15:00 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/09/20‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

15:00

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (09/20 Lab notebook)

N    

14:57

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/09/20 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

N    14:57 

User:Maryam Yamadi/Notebook/Experimental Biological Chemistry I/2017/09/19‎‎ (2 changes | history) . . (+968). . [Maryam Yamadi‎ (2×)]

     

14:57

(cur | prev) . . (+18). . Maryam Yamadi (talk | contribs) (09/19 Lab Notebook)

N    

14:56

(cur | prev) . . (+950). . Maryam Yamadi (talk | contribs) (Autocreate 2017/09/19 Entry for User:Maryam_Yamadi/Notebook/Experimental_Biological_Chemistry_I)

     14:14 

Rich Lab:Important Lab Documents‎‎ (2 changes | history) . . (+1,142). . [Isabel C. Morales‎ (2×)]

     

14:14

(cur | prev) . . (+1). . Isabel C. Morales (talk | contribs)

     

14:12

(cur | prev) . . (+1,141). . Isabel C. Morales (talk | contribs) (Lab Contact List)

     13:27 

CONJ606:Materials‎‎ (2 changes | history) . . (+36). . [Jamesonn‎ (2×)]

     

13:27

(cur | prev) . . (0). . Jamesonn (talk | contribs) (Week 3: TZAP: The Tonsorial Telomere Protein)

     

13:26

(cur | prev) . . (+36). . Jamesonn (talk | contribs) (Week 3:)

     13:17  User:Jamesonn‎ (diff | hist) . . (+27). . Maureen E. Hoatlin (talk | contribs)

     13:16 

CONJ606:People‎‎ (3 changes | history) . . (+259). . [Maureen E. Hoatlin‎; Jamesonn‎ (2×)]

     

13:16

(cur | prev) . . (+69). . Maureen E. Hoatlin (talk | contribs) (Students)

     

13:12

(cur | prev) . . (+8). . Jamesonn (talk | contribs) (Students)

     

13:11

(cur | prev) . . (+182). . Jamesonn (talk | contribs) (Students)

 m   11:32  Swartz‎ (diff | hist) . . (-166). . Julie A. Fogarty (talk | contribs)
     06:33  Lee:JC‎ (diff | hist) . . (+22). . Wooin Lee (talk | contribs) (Lab meeting schedule)

     06:21 

Gao lab:Members‎‎ (2 changes | history) . . (0). . [Xinyu Liu‎ (2×)]

     

06:21

(cur | prev) . . (+9). . Xinyu Liu (talk | contribs) (Alumni)

     

06:20

(cur | prev) . . (-9). . Xinyu Liu (talk | contribs) (Graduate Students)

     01:09  Waldminghaus:Back Door/Lab Seminar‎ (diff | hist) . . (0). . Torsten Waldminghaus (talk | contribs)

15 October 2017

     19:10 

Qin:Publications‎‎ (5 changes | history) . . (+132). . [Zhenpeng Qin‎ (5×)]

     

19:10

(cur | prev) . . (+2). . Zhenpeng Qin (talk | contribs) (Journal Articles)

     

19:04

(cur | prev) . . (0). . Zhenpeng Qin (talk | contribs) (Journal Articles)

     

19:04

(cur | prev) . . (0). . Zhenpeng Qin (talk | contribs) (Journal Articles)

     

19:03

(cur | prev) . . (+53). . Zhenpeng Qin (talk | contribs) (Journal Articles)

     

18:58

(cur | prev) . . (+77). . Zhenpeng Qin (talk | contribs)

     19:09 

(Upload log). .

[Zhenpeng Qin‎ (2×)]

     

19:09

. . Zhenpeng Qin (talk | contribs) uploaded File:Pub.2016.scirep.jpg

     

19:02

. . Zhenpeng Qin (talk | contribs) uploaded File:Pub.2017.ACSSen.gif

     19:00  Qin:Lab Members‎ (diff | hist) . . (-36). . Zhenpeng Qin (talk | contribs)
     17:00  User:Sayed Massie Husaini/Notebook/september 5 2017/2017/10/04‎ (diff | hist) . . (+25). . Sayed Massie Husaini (talk | contribs) (NMR Sample)