Difference between revisions of "840:153g:Projects/project24"

From OpenWetWare
Jump to: navigation, search
m
(44 intermediate revisions by 3 users not shown)
Line 14: Line 14:
 
|colspan="2"|
 
|colspan="2"|
 
==Team Members==
 
==Team Members==
* Name of student Sanju Timilsina
+
* Sanju Timilsina
* Name of student Parul Sirohi
+
* Parul Sirohi
  
==Over expression of Acetyl- CoA carboxylase (ACC)sub-unit accC in E.coli to enhance fatty acid accumulation for Bio-fuel production”.==
+
==Over expression of ''E. coli'' Acetyl- CoA carboxylase (ACC)sub-unit accC in ''E.coli'' to enhance fatty acid accumulation for Bio-fuel production”.==
* Source Organism: E. coli 0157:H7�
+
* Source Organism:'' E. coli'' 0157:H7
PROJECT DESCRIPTION:
 
Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis. TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will clone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do thin layer chromatography for the quantification of fatty acids. 
 
  
Source: Biology department of University of Northern Iowa�
+
=='''Project Description'''==
Media: Luria Broth�
+
Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids. 
Gene: Acetyl CoA carboxylase biotin carboxylase (accC)
 
Assembly #: NC_011353.1 Region: 4242644..4243993�
 
Introns: None because Bacteria does not have any introns.
 
Bio-brick Compatibility: Compatible
 
Plasmid used: Vector Plasmid pSB1A3
 
Promoter used:Part: BBa_J23100
 
PCR primers for accC gene
 
Primers:                                                
 
  
 +
=='''Overview'''==
 +
*'''Source:''' Biology department of University of Northern Iowa
 +
*'''Media:''' Luria Broth
 +
*'''Gene:''' Acetyl CoA carboxylase biotin carboxylase (accC)
 +
*'''Accession no.:''' NC_011353.1 Region: 4242644..4243993 total base pair- 1350
 +
*'''Introns''': None because Bacteria does not have any introns.
 +
*'''Bio-brick Compatibility:''' Compatible
 +
*'''Plasmid used''': Vector Plasmid pSB1A3
 +
*'''Promoter used''':Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc
  
24F_Biofuel1P  5’gaattcgcggccgcttctagag atgctggataaaattgttattgccaaccgc 3’                             
+
==Alternative Promoters:==
24RP_Biofuel2S  5’ctgcagactaga          cgagttttttctccagatagtggatgttagtgc3’
+
*'''BBa-K206000(PBad)''': is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC.
 +
*'''J23109:RFP-106''' tttacagctagctcagtcctagggactgtgctagc (is medium promoter)
  
24F_Biofuel1    5’ atgctggataaaattgttattgccaaccgc 3’
+
=='''PCR primers for accC gene'''==
24RP_Biofuel2  5’ cgagttttttctccagatagtggatgttagtgc3’
 
  
                       
+
*• 24F_Biofuel1P      --  5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’
 +
*• 24RP_Biofuel2S  --  5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’
  
 +
*• 24F_Biofuel1      --  5’ atgctggataaaattgttattgccaaccgc 3’
 +
*• 24RP_Biofuel2    --  5’ cgagttttttctccagatagtggatgttagtgc3’
  
 
+
=='''Steps for project'''==
'''Function of gene''': accC is a precursor enzyme which regulates the intermediate bio-synthetic step of Triacyl glycerol production ( fatty acid which is used to produce bio-fuel)
+
*• Grow the  source organism (E. coli)
 +
*• DNA extraction from the source (E. coli)
 +
*• Electrophoresis to check desired DNA segment (bp)
 +
*• Primer designing
 +
*• Multiplication of  gene of interest by PCR
 +
*• Electrophorosis
 +
*• Digestion of Plasmid and gene by restriction enzymes
 +
*• Ligation of accC gene in plasmid vector (pSB1A3)
 +
*• Transformation of vector plasmid  into host organism E. coli
 +
*• Cloning of cells in a LB media
 +
*• Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin)
 +
*• Inoculation of E.coli in biomass
 +
*• Testing of protein Acetyl CoA carboxylase biotin carboxylage by SDS-PAGE and fatty acid by thin layer chromatography
  
'''Introduction''':The gene of interest in this project is accC ( Acetyl Co-A carboxylase biotin carboxylase).This gene catalyze the formation of malonyl-CoA substrate for biosynthesis of fatty acid synthesis.
 
ACC is a multi subunit( accA, accB, accC and accD) enzyme in most prokaryotes. It is also found in the chloroplast of most of plant and algae.
 
Fatty acid is the major prerequisite for bio-fuel production, so its over production might enhance bio-fuel production.
 
Overexpression of the enzyme DGAT  is most likely to enhance  lipid, Tri-acylglycerol over production but due to high introns numbers in the source ( Arabidopsis thaliana) we chose  ACC over DGAT
 
  
'''3 major biochemical steps:'''
+
 
 
+
=='''References'''==
1. Carboxylation of acetyl- CoA to form malonyl CoA by enzyme ACC which has four sub-unit (accA,accB,accC and accD)
+
*• Magnuson, K.,  Jackowski, S.,  Rock, C.O., and Cronan,  J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli.  Microbial Rev.57(3):522
2.Acyl chain elongation
+
*http://mmbr.asm.org/content/57/3/522.full.pdf+html
3.TAG formation.
+
*• Noemie,  M.  D.,  Parisien,  A.,  Wang, B., Lan, C.,  ( 2009). Enhancement of lipid production using biochemical, genetic and  transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41
 +
*http://www.sciencedirect.com/science/article/pii/S0168165609000959
 +
*• Siaut,  M.,  Cuine, S., Cagnon, C., Fessler, B., Nguyen, M., Carrier, P., Bryly, A., Beisson, F., Triantaphylides, C., Beisson, L., and Peltier, G., (2011). Oil Accumulation in the model green algae Chlamydomonas reinhardetii: characterization, variability between common laboratory strains and relationship with starch reserves. BMC Biotechnol 2011: 117
 +
*http://www.biomedcentral.com/1472-6750/11/7
  
 
+
==''''''Presentation'''''':==
* [['''Steps for project:''']]
 
1.Grow the  source organism (E. coli)
 
2.DNA extraction from the source (E. coli)
 
3.Electrophoresis to check desired DNA segment (bp)
 
4.Primer designing
 
5.Multiplication of  gene of interest by PCR
 
6.Electrophorosis
 
7.Digestion of Plasmid by restriction enzymes ( cut plasmid with S+P i.e bp2 and gene of interest with X+P i.e bp 2149 and P at bp20 )
 
8.Ligation of accC gene in plasmid vector (pSB1A3)
 
9.Transformation of vector plasmid  into host organism E. coli
 
10.Cloning of cells in a LB media
 
11.Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin)
 
12.Inoculation of E.coli in biomass
 
13.Testing of fatty acid  by High pressure thin layer chromatography
 
* Do not go into experimental details and don't list procedures. Just list the major steps necessary to complete your project
 
* Please also make yourself familiar with uploading pictures and *.ppt files
 
  
 +
*Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx (file) <br>
 +
*http://openwetware.org/images/4/42/Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx                                             
 +
 
==Important Results and Milestones==
 
==Important Results and Milestones==
 
* keep track of your most important results and refer to the corresponding page in your notebook
 
* keep track of your most important results and refer to the corresponding page in your notebook

Revision as of 11:25, 18 September 2012

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext">09/11/2012,09/17/2012,09/20/2012,09/27/2012,10/04/2012,10/11/2012,10/16/2012,10/18/2012,10/22/2012,10/25/2012,11/01/2012,11/08/2012,11/15/2012</div><div style="display:none;" id="page">840:153g:Projects/project24</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html>

Team Members

  • Sanju Timilsina
  • Parul Sirohi

Over expression of E. coli Acetyl- CoA carboxylase (ACC)sub-unit accC in E.coli to enhance fatty acid accumulation for Bio-fuel production”.

  • Source Organism: E. coli 0157:H7

Project Description

Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids.

Overview

  • Source: Biology department of University of Northern Iowa
  • Media: Luria Broth
  • Gene: Acetyl CoA carboxylase biotin carboxylase (accC)
  • Accession no.: NC_011353.1 Region: 4242644..4243993 total base pair- 1350
  • Introns: None because Bacteria does not have any introns.
  • Bio-brick Compatibility: Compatible
  • Plasmid used: Vector Plasmid pSB1A3
  • Promoter used:Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc

Alternative Promoters:

  • BBa-K206000(PBad): is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC.
  • J23109:RFP-106 tttacagctagctcagtcctagggactgtgctagc (is medium promoter)

PCR primers for accC gene

  • • 24F_Biofuel1P -- 5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’
  • • 24RP_Biofuel2S -- 5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’
  • • 24F_Biofuel1 -- 5’ atgctggataaaattgttattgccaaccgc 3’
  • • 24RP_Biofuel2 -- 5’ cgagttttttctccagatagtggatgttagtgc3’

Steps for project

  • • Grow the source organism (E. coli)
  • • DNA extraction from the source (E. coli)
  • • Electrophoresis to check desired DNA segment (bp)
  • • Primer designing
  • • Multiplication of gene of interest by PCR
  • • Electrophorosis
  • • Digestion of Plasmid and gene by restriction enzymes
  • • Ligation of accC gene in plasmid vector (pSB1A3)
  • • Transformation of vector plasmid into host organism E. coli
  • • Cloning of cells in a LB media
  • • Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin)
  • • Inoculation of E.coli in biomass
  • • Testing of protein Acetyl CoA carboxylase biotin carboxylage by SDS-PAGE and fatty acid by thin layer chromatography


References

  • • Magnuson, K., Jackowski, S., Rock, C.O., and Cronan, J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli. Microbial Rev.57(3):522
  • http://mmbr.asm.org/content/57/3/522.full.pdf+html
  • • Noemie, M. D., Parisien, A., Wang, B., Lan, C., ( 2009). Enhancement of lipid production using biochemical, genetic and transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41
  • http://www.sciencedirect.com/science/article/pii/S0168165609000959
  • • Siaut, M., Cuine, S., Cagnon, C., Fessler, B., Nguyen, M., Carrier, P., Bryly, A., Beisson, F., Triantaphylides, C., Beisson, L., and Peltier, G., (2011). Oil Accumulation in the model green algae Chlamydomonas reinhardetii: characterization, variability between common laboratory strains and relationship with starch reserves. BMC Biotechnol 2011: 117
  • http://www.biomedcentral.com/1472-6750/11/7

'Presentation':

Important Results and Milestones

  • keep track of your most important results and refer to the corresponding page in your notebook
  • upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).
Recent changes

19 October 2017

     07:06 (User creation log) . . User account Newfish (talk | contribs) was created by Yar (talk | contribs) and password was sent by email ‎

     04:10 

BioMicroCenter:BioinfoClasses‎‎ (3 changes | history) . . (+132). . [Charlie Whittaker‎ (3×)]

     

04:10

(cur | prev) . . (+9). . Charlie Whittaker (talk | contribs) (Teaching Schedule)

     

04:09

(cur | prev) . . (0). . Charlie Whittaker (talk | contribs) (Teaching Schedule)

     

04:08

(cur | prev) . . (+123). . Charlie Whittaker (talk | contribs) (Teaching Schedule)

     03:36  User:Timothee Flutre‎ (diff | hist) . . (+146). . Timothee Flutre (talk | contribs) (add contrib breedR and SO)

 m   02:27 

How to write a research paper‎‎ (2 changes | history) . . (+91). . [Formand‎ (2×)]

 m   

02:27

(cur | prev) . . (-1). . Formand (talk | contribs) (External links)

 m   

02:24

(cur | prev) . . (+92). . Formand (talk | contribs) (External links)

18 October 2017

     19:09  BME100 f2017:Group10 W0800 L4‎ (diff | hist) . . (+1). . Osvaldo J Pagan (talk | contribs)

     15:56 

BME100 f2017:Group8 W1030 L4‎‎ (2 changes | history) . . (+426). . [Jennifer L. Brodsky‎; Jacob Tomas Harrison Haye‎]

     

15:56

(cur | prev) . . (+409). . Jennifer L. Brodsky (talk | contribs) (Research and Development)

     

14:17

(cur | prev) . . (+17). . Jacob Tomas Harrison Haye (talk | contribs) (SNP Information & Primer Design)

     15:20  BME100 f2017:Group7 W0800 L4‎ (diff | hist) . . (-4). . Miguel R. Almanza Lopez (talk | contribs) (OUR TEAM)

     15:16 

(Upload log). .

[Miguel R. Almanza Lopez‎; Kaifu Chen‎ (2×); Jacob Tomas Harrison Haye‎ (4×); Alivia Ankrum‎ (8×)]

     

15:16

. . Miguel R. Almanza Lopez (talk | contribs) uploaded File:MralPoopy.jpg

     

14:39

. . Kaifu Chen (talk | contribs) uploaded File:Jcm.jpg

     

14:38

. . Kaifu Chen (talk | contribs) uploaded File:Wgy.jpg

     

14:25

. . Jacob Tomas Harrison Haye (talk | contribs) uploaded a new version of File:DNA4.jpg

     

14:25

. . Jacob Tomas Harrison Haye (talk | contribs) uploaded a new version of File:DNA4.jpg

     

14:22

. . Jacob Tomas Harrison Haye (talk | contribs) uploaded a new version of File:DNA3.jpg

     

14:18

. . Jacob Tomas Harrison Haye (talk | contribs) uploaded File:DNA4.jpg

     

14:18

. . Alivia Ankrum (talk | contribs) uploaded File:Badg12.png

     

14:10

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Goodresultsg12.png

     

14:07

. . Alivia Ankrum (talk | contribs) uploaded File:Goodresultsg12.png

     

14:06

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Screenshot1.png

     

13:43

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Screen Shot 2017-10-18 at 1.26.01 PM.png

     

13:41

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Screen Shot 2017-10-18 at 1.26.01 PM.png

     

13:41

. . Alivia Ankrum (talk | contribs) uploaded a new version of File:Screen Shot 2017-10-18 at 1.26.01 PM.png

     

13:39

. . Alivia Ankrum (talk | contribs) uploaded File:Screen Shot 2017-10-18 at 1.26.01 PM.png

     14:40 

BME100 f2017:Group1 W1030 L4‎‎ (13 changes | history) . . (+1,253). . [Emily A. Hanzlick‎ (6×); Abby E. Krell‎ (7×)]

     

14:40

(cur | prev) . . (+33). . Abby E. Krell (talk | contribs) (Protocol)

     

14:39

(cur | prev) . . (+28). . Abby E. Krell (talk | contribs) (Protocol)

     

14:38

(cur | prev) . . (+220). . Abby E. Krell (talk | contribs) (Protocol)

     

14:35

(cur | prev) . . (+178). . Abby E. Krell (talk | contribs) (Protocol)

     

14:32

(cur | prev) . . (+4). . Abby E. Krell (talk | contribs) (Research and Development)

     

14:32

(cur | prev) . . (0). . Abby E. Krell (talk | contribs) (Research and Development)

     

14:30

(cur | prev) . . (+17). . Abby E. Krell (talk | contribs) (Protocol)

     

14:01

(cur | prev) . . (+23). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:59

(cur | prev) . . (-12). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:56

(cur | prev) . . (+5). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:41

(cur | prev) . . (+177). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:36

(cur | prev) . . (+427). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     

13:31

(cur | prev) . . (+153). . Emily A. Hanzlick (talk | contribs) (Research and Development)

     14:19 

BME100 f2017:Group12 W1030 L4‎‎ (8 changes | history) . . (+713). . [Alivia Ankrum‎ (8×)]

     

14:19

(cur | prev) . . (0). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

14:19

(cur | prev) . . (+30). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

14:14

(cur | prev) . . (0). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

14:13

(cur | prev) . . (+38). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

13:36

(cur | prev) . . (+30). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

13:35

(cur | prev) . . (+53). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

13:32

(cur | prev) . . (+8). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     

13:31

(cur | prev) . . (+554). . Alivia Ankrum (talk | contribs) (SNP Information & Primer Design)

     13:57 

BME100 f2017:Group11 W1030 L4‎‎ (3 changes | history) . . (-107). . [Zoe Marmitt‎ (3×)]

     

13:57

(cur | prev) . . (-1). . Zoe Marmitt (talk | contribs) (Protocol)

     

13:53

(cur | prev) . . (+2). . Zoe Marmitt (talk | contribs) (Protocol)

     

13:52

(cur | prev) . . (-108). . Zoe Marmitt (talk | contribs) (Protocol)