Difference between revisions of "840:153g:Projects/project24"

From OpenWetWare
Jump to: navigation, search
Line 39: Line 39:
 
'''PCR primers for accC gene'''
 
'''PCR primers for accC gene'''
  
*• 24F_Biofuel1P       5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’
+
*• 24F_Biofuel1P   --  5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’
*• 24RP_Biofuel2S     5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’
+
*• 24RP_Biofuel2S   --  5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’
  
*• 24F_Biofuel1       5’ atgctggataaaattgttattgccaaccgc 3’
+
*• 24F_Biofuel1     --  5’ atgctggataaaattgttattgccaaccgc 3’
*• 24RP_Biofuel2       5’ cgagttttttctccagatagtggatgttagtgc3’
+
*• 24RP_Biofuel2   --  5’ cgagttttttctccagatagtggatgttagtgc3’
  
 
• [['''Steps for project:''']]
 
• [['''Steps for project:''']]

Revision as of 11:33, 13 September 2012

Insert non-formatted text here{|border="1" cellpadding="4" cellspacing="0" style="border:#c9c9c9 1px solid; margin: 1em 1em 1em 0; border-collapse: collapse;" width="800" |-<nowiki>Insert non-formatted text here</nowiki> |style="background-color: #cdde95;" align="center"| <!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext">09/11/2012,09/17/2012,09/20/2012,09/27/2012,10/04/2012,10/11/2012,10/16/2012,10/18/2012,10/22/2012,10/25/2012,11/01/2012,11/08/2012,11/15/2012</div><div style="display:none;" id="page">840:153g:Projects/project24</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div> |align="center" style="background-color: #e5edc8;" | Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch> |- |colspan="2" style="background-color: #F2F2F2;" align="right"|Customize your entry pages <html><img src="/images/a/aa/Help.png" border="0" /></html> |- |colspan="2"|

Team Members

  • Sanju Timilsina
  • Parul Sirohi

Over expression of E. coli Acetyl- CoA carboxylase (ACC)sub-unit accC in E.coli to enhance fatty acid accumulation for Bio-fuel production”.

  • Source Organism: E. coli 0157:H7

PROJECT DESCRIPTION Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids.


  • Source: Biology department of University of Northern Iowa
  • Media: Luria Broth
  • Gene: Acetyl CoA carboxylase biotin carboxylase (accC)
  • Accession no.: NC_011353.1 Region: 4242644..4243993 total base pair- 1350
  • Introns: None because Bacteria does not have any introns.
  • Bio-brick Compatibility: Compatible
  • Plasmid used: Vector Plasmid pSB1A3
  • Promoter used:Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc

Alternative Promoters:

  • BBa-K206000(PBad): is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC.
  • J23109:RFP-106 tttacagctagctcagtcctagggactgtgctagc (is medium promoter)

PCR primers for accC gene

  • • 24F_Biofuel1P -- 5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’
  • • 24RP_Biofuel2S -- 5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’
  • • 24F_Biofuel1 -- 5’ atgctggataaaattgttattgccaaccgc 3’
  • • 24RP_Biofuel2 -- 5’ cgagttttttctccagatagtggatgttagtgc3’

'''Steps for project:'''

  • • Grow the source organism (E. coli)
  • • DNA extraction from the source (E. coli)
  • • Electrophoresis to check desired DNA segment (bp)
  • • Primer designing
  • • Multiplication of gene of interest by PCR
  • • Electrophorosis
  • • Digestion of Plasmid and gene by restriction enzymes
  • • Ligation of accC gene in plasmid vector (pSB1A3)
  • • Transformation of vector plasmid into host organism E. coli
  • • Cloning of cells in a LB media
  • • Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin)
  • • Inoculation of E.coli in biomass
  • • Testing of protein Acetyl CoA carboxylase biotin carboxylage by SDS-PAGE and fatty acid by thin layer chromatography


References:

  • • Magnuson, K., Jackowski, S., Rock, C.O., and Cronan, J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli. Microbial Rev.57(3):522
  • • Noemie, M. D., Parisien, A., Wang, B., Lan, C., ( 2009). Enhancement of lipid production using biochemical, genetic and transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41
  • http://partsregistry.org/Main_Page
  • http://www.ncbi.nlm.nih.gov/
  • http://scholar.google.com/

Presentation:

Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx (file)
http://openwetware.org/images/4/42/Fuel_it_up_FINAL_Slides_-_Copy_corrected_after_presentation.pptx

Important Results and Milestones

  • keep track of your most important results and refer to the corresponding page in your notebook
  • upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).

|- |colspan="2" style="background-color: #F2F2F2;"|

Recent changes

19 October 2017

     14:58 

CONJ606:Materials‎‎ (2 changes | history) . . (+1,004). . [Weinjule‎; Peteral‎]

     

14:58

(cur | prev) . . (+685). . Peteral (talk | contribs) (Week 2: Me Myself and I-dentifiers, The Key To Immortality (Persistence))

     

12:15

(cur | prev) . . (+319). . Weinjule (talk | contribs) (Papers)

     14:52 

User:Peteral‎‎ (3 changes | history) . . (+1,264). . [Peteral‎ (3×)]

     

14:52

(cur | prev) . . (+185). . Peteral (talk | contribs) (Alec's Discussion Questions)

     

13:52

(cur | prev) . . (+351). . Peteral (talk | contribs) (Alec's Discussion Questions)

     

10:53

(cur | prev) . . (+728). . Peteral (talk | contribs) (Alec's Discussion Questions)

     14:13 

BME100 f2017:Group14 W0800 L4‎‎ (9 changes | history) . . (+9). . [Shae M. Diaz‎ (9×)]

     

14:13

(cur | prev) . . (+8). . Shae M. Diaz (talk | contribs) (Protocol)

     

14:12

(cur | prev) . . (-31). . Shae M. Diaz (talk | contribs) (TEAM MEMBERS)

     

14:10

(cur | prev) . . (+31). . Shae M. Diaz (talk | contribs) (TEAM MEMBERS)

     

14:09

(cur | prev) . . (+4). . Shae M. Diaz (talk | contribs) (TEAM MEMBERS)

     

14:05

(cur | prev) . . (-1). . Shae M. Diaz (talk | contribs) (TEAM MEMBERS)

     

14:05

(cur | prev) . . (+1). . Shae M. Diaz (talk | contribs) (TEAM MEMBERS)

     

14:04

(cur | prev) . . (-1). . Shae M. Diaz (talk | contribs) (TEAM MEMBERS)

     

13:55

(cur | prev) . . (+1). . Shae M. Diaz (talk | contribs) (TEAM MEMBERS)

     

13:55

(cur | prev) . . (-3). . Shae M. Diaz (talk | contribs) (TEAM MEMBERS)

 m   14:12  Swartz‎ (diff | hist) . . (+61). . Marcus Rohovie (talk | contribs)
     14:10 (Move log) . . Marcus Rohovie (talk | contribs) moved page Swartz to Swartz:Main

     14:08 

(Upload log). .

[Thorntca‎; Shae M. Diaz‎ (3×)]

     

14:08

. . Shae M. Diaz (talk | contribs) uploaded File:100profileshae.JPG

     

14:01

. . Shae M. Diaz (talk | contribs) uploaded File:Shaediaz100.JPG

     

13:51

. . Shae M. Diaz (talk | contribs) uploaded File:BME100ShaeD.JPG

     

13:17

. . Thorntca (talk | contribs) uploaded File:2Dgel.png.jpg

     14:06  Rich Lab:Funding‎ (diff | hist) . . (-24). . Isabel C. Morales (talk | contribs)

     13:52 

Klenow Assembly Method: Seamless cloning‎‎ (3 changes | history) . . (+101). . [David M.D. Bailey‎ (3×)]

     

13:52

(cur | prev) . . (-5). . David M.D. Bailey (talk | contribs) (The Klenow Assembly Method (KAM) for the seamless cloning of overlapping double stranded DNA fragments: Very cheap alternative to the Gibson Assembly)

     

13:51

(cur | prev) . . (+1). . David M.D. Bailey (talk | contribs) (The Klenow Assembly Method (KAM) for the seamless cloning of overlapping double stranded DNA fragments: Very cheap alternative to the Gibson Assembly)

     

13:50

(cur | prev) . . (+105). . David M.D. Bailey (talk | contribs) (The Klenow Assembly Method (KAM) for the seamless cloning of overlapping double stranded DNA fragments: Very cheap alternative to the Gibson Assembly)

     13:22 

User:Thorntca‎‎ (8 changes | history) . . (+529). . [Thorntca‎ (8×)]

     

13:22

(cur | prev) . . (+145). . Thorntca (talk | contribs)

     

13:19

(cur | prev) . . (+17). . Thorntca (talk | contribs)

     

13:19

(cur | prev) . . (+4). . Thorntca (talk | contribs)

     

13:18

(cur | prev) . . (+30). . Thorntca (talk | contribs)

     

13:16

(cur | prev) . . (+417). . Thorntca (talk | contribs)

     

12:52

(cur | prev) . . (+12). . Thorntca (talk | contribs)

     

12:51

(cur | prev) . . (-5). . Thorntca (talk | contribs)

     

12:51

(cur | prev) . . (-91). . Thorntca (talk | contribs)

     12:27 

User:Madeline.churchill‎‎ (2 changes | history) . . (+302). . [Madeline.churchill‎ (2×)]

     

12:27

(cur | prev) . . (0). . Madeline.churchill (talk | contribs) (TZAP protein controls telomere Trimming process)

     

12:27

(cur | prev) . . (+302). . Madeline.churchill (talk | contribs) (Madeline Churchill's Discussion Page)

     09:17  BioMicroCenter:BIG meeting‎ (diff | hist) . . (+19). . George W Bell (talk | contribs) (2017-2018 academic year)
     07:06 (User creation log) . . User account Newfish (talk | contribs) was created by Yar (talk | contribs) and password was sent by email ‎

     04:10 

BioMicroCenter:BioinfoClasses‎‎ (3 changes | history) . . (+132). . [Charlie Whittaker‎ (3×)]

     

04:10

(cur | prev) . . (+9). . Charlie Whittaker (talk | contribs) (Teaching Schedule)

     

04:09

(cur | prev) . . (0). . Charlie Whittaker (talk | contribs) (Teaching Schedule)

     

04:08

(cur | prev) . . (+123). . Charlie Whittaker (talk | contribs) (Teaching Schedule)

     03:36  User:Timothee Flutre‎ (diff | hist) . . (+146). . Timothee Flutre (talk | contribs) (add contrib breedR and SO)

 m   02:27 

How to write a research paper‎‎ (2 changes | history) . . (+91). . [Formand‎ (2×)]

 m   

02:27

(cur | prev) . . (-1). . Formand (talk | contribs) (External links)

 m   

02:24

(cur | prev) . . (+92). . Formand (talk | contribs) (External links)

18 October 2017

     19:09  BME100 f2017:Group10 W0800 L4‎ (diff | hist) . . (+1). . Osvaldo J Pagan (talk | contribs)
     15:56  BME100 f2017:Group8 W1030 L4‎ (diff | hist) . . (+409). . Jennifer L. Brodsky (talk | contribs) (Research and Development)
     15:20  BME100 f2017:Group7 W0800 L4‎ (diff | hist) . . (-4). . Miguel R. Almanza Lopez (talk | contribs) (OUR TEAM)

     15:16 

(Upload log). .

[Miguel R. Almanza Lopez‎; Kaifu Chen‎]

     

15:16

. . Miguel R. Almanza Lopez (talk | contribs) uploaded File:MralPoopy.jpg

     

14:39

. . Kaifu Chen (talk | contribs) uploaded File:Jcm.jpg

     14:40 

BME100 f2017:Group1 W1030 L4‎‎ (3 changes | history) . . (+281). . [Abby E. Krell‎ (3×)]

     

14:40

(cur | prev) . . (+33). . Abby E. Krell (talk | contribs) (Protocol)

     

14:39

(cur | prev) . . (+28). . Abby E. Krell (talk | contribs) (Protocol)

     

14:38

(cur | prev) . . (+220). . Abby E. Krell (talk | contribs) (Protocol)

|}