Difference between revisions of "840:153g:Projects/project24"

From OpenWetWare
Jump to: navigation, search
(fix raw html help text)
(2 intermediate revisions by one other user not shown)
Line 10: Line 10:
<!-- ## END search column  ## -->
<!-- ## END search column  ## -->
|colspan="2" style="background-color: #F2F2F2;" align="right"|[[{{FULLPAGENAME}}/Entry_Base|Customize your entry pages]] [[Help:Notebook/Project_Base/Customize_entry_page|<html><img src="/images/a/aa/Help.png" border="0" /></html>]]
|colspan="2" style="background-color: #F2F2F2;" align="right"|[[{{FULLPAGENAME}}/Entry_Base|Customize your entry pages]] [[Image:Help.png|frameless|link=Help:Notebook/Project_Base/Customize_entry_page]]
Line 76: Line 76:
*Fuel it up Final Project presentation
*Fuel it up Final Project presentation
* http://openwetware.org/wiki/Image:Group_25_final_presentation.pptx                                        
==Important Results and Milestones==
==Important Results and Milestones==

Latest revision as of 18:20, 23 September 2017

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext">09/11/2012,09/17/2012,09/20/2012,09/27/2012,10/04/2012,10/11/2012,10/16/2012,10/18/2012,10/22/2012,10/25/2012,11/01/2012,11/08/2012,11/15/2012</div><div style="display:none;" id="page">840:153g:Projects/project24</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages Help.png

Team Members

  • Sanju Timilsina
  • Parul Sirohi

Over expression of E. coli Acetyl- CoA carboxylase (ACC)sub-unit accC in E.coli to enhance fatty acid accumulation for Bio-fuel production”.

  • Source Organism: E. coli 0157:H7

Project Description

Our gene of interest is accC gene from E. coli 0157:H7 accC gene is the biotin subunit of ACC enzyme which catalyze the biosynthesis of Malonyl CoA. Malonyl CoA controls the rate of fatty acid (Triacylglycerol) biosynthesis.TAG is the fatty acid i.e. used for the biofuel production.In this experiment we will identify if the overexpression of accC gene in E.coli might enhance the production of TAG. For this process we will chttp://openwetware.org/skins/common/images/button_bold.pnglone our gene of interest in to plasmid pSB1A3 and transform it in host E. coli. We will do SDS-PAGE for detection of protein and thin layer chromatography for the quantification of fatty acids.


  • Source: Biology department of University of Northern Iowa
  • Media: Luria Broth
  • Gene: Acetyl CoA carboxylase biotin carboxylase (accC)
  • Accession no.: NC_011353.1 Region: 4242644..4243993 total base pair- 1350
  • Introns: None because Bacteria does not have any introns.
  • Bio-brick Compatibility: Compatible
  • Plasmid used: Vector Plasmid pSB1A3
  • Promoter used:Part: BBa_J23100 ttgacggctagctcagtcctaggtacagtgctagc

Alternative Promoters:

  • BBa-K206000(PBad): is strong E.coli promoter controlled by L-arabinose inducer and is repressed by AraC.
  • J23109:RFP-106 tttacagctagctcagtcctagggactgtgctagc (is medium promoter)

PCR primers for accC gene

  • • 24F_Biofuel1P -- 5’gaattcgcggccgcttctagagatgctggataaaattgttattgccaaccgc 3’
  • • 24RP_Biofuel2S -- 5’tactagtagcggccgctgcagcgagttttttctccagatagtggatgttagtgc3’
  • • 24F_Biofuel1 -- 5’ atgctggataaaattgttattgccaaccgc 3’
  • • 24RP_Biofuel2 -- 5’ cgagttttttctccagatagtggatgttagtgc3’

Steps for project

  • • Grow the source organism (E. coli)
  • • DNA extraction from the source (E. coli)
  • • Electrophoresis to check desired DNA segment (bp)
  • • Primer designing
  • • Multiplication of gene of interest by PCR
  • • Electrophorosis
  • • Digestion of Plasmid and gene by restriction enzymes
  • • Ligation of accC gene in plasmid vector (pSB1A3)
  • • Transformation of vector plasmid into host organism E. coli
  • • Cloning of cells in a LB media
  • • Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin)
  • • Inoculation of E.coli in biomass
  • • Testing of protein Acetyl CoA carboxylase biotin carboxylage by SDS-PAGE and fatty acid by thin layer chromatography


  • • Magnuson, K., Jackowski, S., Rock, C.O., and Cronan, J.E.(1993).Regulation of fatty acid biosynthesis in Escherichia coli. Microbial Rev.57(3):522
  • http://mmbr.asm.org/content/57/3/522.full.pdf+html
  • • Noemie, M. D., Parisien, A., Wang, B., Lan, C., ( 2009). Enhancement of lipid production using biochemical, genetic and transcription factor engineering approaches. Journal of biotechnology, 141 (2009) 31-41
  • http://www.sciencedirect.com/science/article/pii/S0168165609000959
  • • Siaut, M., Cuine, S., Cagnon, C., Fessler, B., Nguyen, M., Carrier, P., Bryly, A., Beisson, F., Triantaphylides, C., Beisson, L., and Peltier, G., (2011). Oil Accumulation in the model green algae Chlamydomonas reinhardetii: characterization, variability between common laboratory strains and relationship with starch reserves. BMC Biotechnol 2011: 117
  • http://www.biomedcentral.com/1472-6750/11/7


Important Results and Milestones

  • keep track of your most important results and refer to the corresponding page in your notebook
  • upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).
Recent changes

25 September 2017


(Upload log). .

[Trevor S. Heaton‎; Anshul Krishnan‎ (2×); Vinh T. Le‎ (3×)]



. . Vinh T. Le (talk | contribs) uploaded File:ZOLA9252017 3.PNG



. . Vinh T. Le (talk | contribs) uploaded File:ZOLA9252017 2.PNG



. . Vinh T. Le (talk | contribs) uploaded File:ZOLA9252017 1.PNG



. . Trevor S. Heaton (talk | contribs) uploaded a new version of File:Graph 1.PNG



. . Anshul Krishnan (talk | contribs) uploaded File:BME100TempVTrials.png



. . Anshul Krishnan (talk | contribs) uploaded File:BME100L3Temp.png

24 September 2017

N    22:33  MediaWiki:Tagline‎ (diff | hist) . . (+16). . Yardena Cohen (talk | contribs) (less parsing)
N    22:32  MediaWiki:Pagetitle-view-mainpage‎ (diff | hist) . . (+11). . Yardena Cohen (talk | contribs) (less parsing)
N    22:32  MediaWiki:Opensearch-desc‎ (diff | hist) . . (+16). . Yardena Cohen (talk | contribs) (english-only?)
N    21:21  MediaWiki:Pagetitle‎ (diff | hist) . . (+16). . Yardena Cohen (talk | contribs) (idk if this will help or hurt)
N    21:18  MediaWiki:Aboutsite‎ (diff | hist) . . (+17). . Yardena Cohen (talk | contribs) (one less thing to parse)


(Upload log). .

[Anna Hoge‎ (2×)]



. . Anna Hoge (talk | contribs) uploaded File:AHgraph4.png



. . Anna Hoge (talk | contribs) uploaded File:AHgraph3.png

23 September 2017

     17:17  MediaWiki:Contactpage-pagetext‎ (diff | hist) . . (+36). . Yardena Cohen (talk | contribs) (don't ask me science questions plz)


(Deletion log). .

[Yardena Cohen‎ (6×)]



. . Yardena Cohen (talk | contribs) deleted page User talk:Deepak P Patil(Automatically deleted when merging users)



. . Yardena Cohen (talk | contribs) deleted page User:Deepak P Patil(Automatically deleted when merging users)



. . Yardena Cohen (talk | contribs) deleted page User talk:Chun H Hsieh(Automatically deleted when merging users)



. . Yardena Cohen (talk | contribs) deleted page User:Chun H Hsieh(Automatically deleted when merging users)



. . Yardena Cohen (talk | contribs) deleted page User talk:Satu Strandman(Automatically deleted when merging users)



. . Yardena Cohen (talk | contribs) deleted page User:Satu Strandman(Automatically deleted when merging users)


(User merge log). .

[Yardena Cohen‎ (6×)]



. . Yardena Cohen (talk | contribs) Deleted user: Deepak P Patil (8544) ‎



. . Yardena Cohen (talk | contribs) User Deepak P Patil (8544) merged to Anonymous (0) ‎



. . Yardena Cohen (talk | contribs) Deleted user: Chun H Hsieh (13046) ‎



. . Yardena Cohen (talk | contribs) User Chun H Hsieh (13046) merged to Anonymous (0) ‎



. . Yardena Cohen (talk | contribs) Deleted user: Satu Strandman (13640) ‎



. . Yardena Cohen (talk | contribs) User Satu Strandman (13640) merged to Anonymous (0) ‎

N    14:04 

MediaWiki:Contactpage-label‎‎ (2 changes | history) . . (+7). . [Yardena Cohen‎ (2×)]



(cur | prev) . . (-4). . Yardena Cohen (talk | contribs) (one word so it doesn't get wrapped)



(cur | prev) . . (+11). . Yardena Cohen (talk | contribs) (label text for footer?)


New server‎‎ (2 changes | history) . . (-137). . [Yardena Cohen‎ (2×)]



(cur | prev) . . (+10). . Yardena Cohen (talk | contribs) (contact form)



(cur | prev) . . (-147). . Yardena Cohen (talk | contribs) (it happened)

N    14:01 

MediaWiki:Contactpage-url‎‎ (4 changes | history) . . (+21). . [Yardena Cohen‎ (4×)]



(cur | prev) . . (-23). . Yardena Cohen (talk | contribs) (relative again)



(cur | prev) . . (-10). . Yardena Cohen (talk | contribs) (actual url)



(cur | prev) . . (+23). . Yardena Cohen (talk | contribs) (full url?)



(cur | prev) . . (+31). . Yardena Cohen (talk | contribs) (relative link)


(User rights log). .

[Yardena Cohen‎ (2×)]



. . Yardena Cohen (talk | contribs) changed group membership for Oww Op from bureaucrat and administrator to staff ‎



. . Yardena Cohen (talk | contribs) changed group membership for Oww Op from (none) to administrator and bureaucrat ‎

     13:47 (User creation log) . . User account Oww Op (talk | contribs) was created by Yardena Cohen (talk | contribs) and password was sent by email ‎
     11:34 (Patrol log) . . Yardena Cohen (talk | contribs) automatically marked revision 996201 of page New server patrolled ‎
     11:33  BIOL398-04/S15:Class Assignments by Week‎ (diff | hist) . . (-3). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Tessa A. Morris Class Assignments by Week to Tessa Morris Class Assignments by Week in a maintenance job.)
     11:33  Paris Bettencourt 2012/Notebook/modularity group/day by day/2012/07‎ (diff | hist) . . (+1). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from IGEM:Paris Bettencourt 2012/Notebook/modularity group/day by day//2012/07 to IGEM:Paris Bettencourt 2012/Notebooks/modularity group/day by day//2012/07 in a maintenance job.)
     11:33  Paris Bettencourt 2012/Notebook/modularity group/day by day/2012/07/03‎ (diff | hist) . . (+1). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from IGEM:Paris Bettencourt 2012/Notebook/modularity group/day by day//2012/07/03 to IGEM:Paris Bettencourt 2012/Notebooks/modularity group/day by day//2012/07/03 in a maintenance job.)
     11:33  BIOMOD/2012/TeamSendaiA/Methods‎ (diff | hist) . . (-1). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from BIOMOD/2012/TeamSendaiA/Methodsa to Biomod/2012/TeamSendaiA/Methods in a maintenance job.)
     11:33  Biomod/2012/TU Dresden/Nanosaurs/Project/Sponsor‎ (diff | hist) . . (+1). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Biomod/2012/TU Dresden/Nanosaurs/Sponsor to Biomod/2012/TU Dresden/Nanosaurs/Sponsors in a maintenance job.)
     11:33  User:Etienne Robillard/Notebook/Phenylmethylamine‎ (diff | hist) . . (-6). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from User:Etienne Robillard/Notebook/Phenylmethanamine to User:Etienne Robillard/Notebook/Benzylamine in a maintenance job.)
     11:33  Farre Lab:Teaching & Research Program‎ (diff | hist) . . (-18). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Farre Lab:Teaching&Research Program to Farre Lab:NSF T&R in a maintenance job.)
     11:33  Farre Lab:Teaching&Research Program‎ (diff | hist) . . (-24). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Farre Lab:Farre-Teaching&Research Program to Farre Lab:NSF T&R in a maintenance job.)
     11:33  Farre Lab:Farre-Teaching&Research Program‎ (diff | hist) . . (-21). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Farre Lab:NSFTeaching&Research Program to Farre Lab:NSF T&R in a maintenance job.)
     11:33  User:Etienne Robillard/Notebook/Chemtrails911 notebook/Agent Ecoli:PhotoReceptorComponent‎ (diff | hist) . . (-26). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from User:Etienne Robillard/Notebook/Agent Ecoli:PhotoReceptorComponent to User:Etienne Robillard/Notebook/Agent BZ in a maintenance job.)
     11:33  BIOX‎ (diff | hist) . . (+9). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Liu BioX to Template:Liu BioX in a maintenance job.)