Difference between revisions of "840:153g:Projects/project10/2010/09/30"

From OpenWetWare
Jump to: navigation, search
(Autocreate 2010/09/30 Entry for 840:153g:Projects/project10)
 
(3 intermediate revisions by the same user not shown)
Line 6: Line 6:
 
| colspan="2"|
 
| colspan="2"|
 
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
 
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
==Entry title==
+
[[Image:[[Image:9_30_10Group10.jpg]]]]==Entry title==
* Insert content here...
+
* This week we finished DNA extraction from P. chrysosporium and ran a gel electrophoresis to determine presence of DNA... it worked! We know it worked because we see DNA on the gel. We also figured out our primers - forward with biobrick extension "Sneezy" GTTTCTTCGAATTCGCGGCCGCTTCTAGCCTTCGTATGTAAGTCGCTG, reverse with biobrick extension "Cowgirl" TACTAGTAGCGGCCGCTGCAGGAAGAAACCGCCGTGCGCGAGTCGCGCG, forward without biobrick extension "Grumpy" CCTTCGTATGTAAGTCGCTG, and reverse without biobrick extension "Cowboy" CGCCGTGCGCGAGTCGCGCG - to be ordered.
 +
Next time we will hopefully receive our primers and run PCR to determine if the primers work.
  
  

Revision as of 11:46, 7 October 2010

Owwnotebook icon.png Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

[[Image:9 30 10Group10.jpg]]==Entry title==

  • This week we finished DNA extraction from P. chrysosporium and ran a gel electrophoresis to determine presence of DNA... it worked! We know it worked because we see DNA on the gel. We also figured out our primers - forward with biobrick extension "Sneezy" GTTTCTTCGAATTCGCGGCCGCTTCTAGCCTTCGTATGTAAGTCGCTG, reverse with biobrick extension "Cowgirl" TACTAGTAGCGGCCGCTGCAGGAAGAAACCGCCGTGCGCGAGTCGCGCG, forward without biobrick extension "Grumpy" CCTTCGTATGTAAGTCGCTG, and reverse without biobrick extension "Cowboy" CGCCGTGCGCGAGTCGCGCG - to be ordered.

Next time we will hopefully receive our primers and run PCR to determine if the primers work.