BME103:W930 Group2 l2

From OpenWetWare
Revision as of 16:30, 28 November 2012 by David D. Rand (talk | contribs)
Jump to navigationJump to search
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Name: Matt Mortensen
Machine Engineer
Name: Garrett Salcido
Open PCR machine engineer
Name: Ramesh Tadayon
Experimental protocol planner
Name: Alanie Harmon
Experimental protocol planner
Name: Alex Torres
R&D Scientist
Name: Davey Rand
R&D Scientist

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


Key Features
Clearly our group was more focused on correcting the lid-opening system for the top of the lid to the box. We focused on designing a new hook-and-latch system for the lid because we felt that the jerky nature of the current system was very inconvenient to the user. Whereas the current model is more difficult to open and yanking it can create potential for harm to be done to the DNA samples, our new design corrects for this by allowing means for a smooth and easy opening motion, and the samples are still protected because the lid is secured by a hook when closed. Considering that our other modification of making the sides thicker was a means to make assembling the device easier, it is reasonable to conclude that overall, we were focused on a greater convenience for the user by making a more user-friendly device.


Instructions
Altered instructions are only needed for the new hook-and-latch system: Instead of instructions to screw the Strike into the top, there will only be instructions to insert the hook into the latch. There will already be another hook for it to catch on the bottom of the lid. There should also be a note for contact information in the event that the hook was damaged or lost in the shipping process.




Protocols

Materials


PCR Protocol



DNA Measurement Protocol



Research and Development

Background on Disease Markers

Crohn's disease is a chronic, autoimmune inflammatory bowel disease (IBD) that causes inflammation of the digestive tract, also known as the gastrointestinal (GI) tract. Chronic, unmanaged inflammation can lead to a variety of symptoms. Researchers have also discovered genetic variations in certain regions of chromosome 5 and chromosome 10 that appear to contribute to Crohn disease risk. One area of chromosome 5, known as the IBD5 locus, contains several genetic changes that may increase the risk of developing this condition. Other regions of chromosome 5 and chromosome 10 identified in studies of Crohn disease risk are known as "gene deserts" because they include no known genes. The SNP's that are associated with this disease are rs11805303, rs10210302, rs9858542 in the BSN gene, rs17234657, rs1000113, rs10761659 and many more.- www.snpedia.com



Primer Design

Rs11805303:
Sequences:
TGCTTGCAAACAGAGAACTGTTTCCT[C]AAACGATCCACTTGCCTTTTATTAG
TGCTTGCAAACAGAGAACTGTTTCCT[T]AAACGATCCACTTGCCTTTTATTAG

Rs10210302:
Sequences:
AATACTGACTACCAGTGAACCATCTT[C]AACTACAGTGCTAGAAGCCTGACTG
AATACTGACTACCAGTGAACCATCTT[T]AACTACAGTGCTAGAAGCCTGACTG




Illustration