BME103:T130 Group 3 l2

From OpenWetWare
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Error creating thumbnail: File missing
Name: Serena Kaplan
Research and Development
Error creating thumbnail: File missing
Name: Gabe McInnis
Open PCR Machine Engineer
Error creating thumbnail: File missing
Name: Blake Eichler
Experimental Protocol Planner
Error creating thumbnail: File missing
Name: Sierra Morris
Experimental Protocol Planner
Error creating thumbnail: File missing
Name: Zazu Moloi
Open PCR Machine Engineer
Error creating thumbnail: File missing
Name: Katelin Vaughn
Research and Development

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


Key Features


Instructions





Protocols

Materials

Supplied in the Kit
PCR Machine
10μM forward primer
10μM reverse primer
GoTaq master mix
Supplied by the User
Template DNA
Distilled Water
Pipets
Eppendorf Tubes

PCR Protocol

1.) Pipet 0.1μL of template DNA, 0.5μL of 10μM forward primer, 0.5μL of 10μM reverse primer, 25.0μL of GoTaq Master Mix, and 23.9μL of dH20 in an Eppendorf tube. All of these items mixed together should create a total volume of 50.0μL.
2.) Up to 16 of these samples are then loaded into the PCR machine
3.) The DNA samples are then heated to ninety-five degrees Celsius (95°C) for one (1) minute in order to unzip the two single strands.
4.) They are then cooled to fifty-seven degrees Celsius (57°C) for ten (10) seconds so that the primers can attach to their matching sequences.
5.) Finally they are heated back to seventy-two degrees Celsius (72°C) for ten (10) seconds and polymerase extends the DNA strands by attaching the correct free nucleotides in order on the single strands.

DNA Measurement Protocol

Error creating thumbnail: File missing

Fluorimeter Setup
1.) The lid was first taken off the the box and one of its sides was unbuttoned in order to create a flap.
2.) The box was the flipped upside down in order to create a dark environment for the camera.
3.) A hydrophobic slide was then inserted into the fluorimeter.
4.) Finally, the camera phone was placed in the stand.

Fluorimeter Measurements
1.) Label transfer pipettes and tubes
2.) Transfer each sample separately into tube containing 400μl of buffer
3.) Take the specifically labeled tube containing SYBR GREEN 1 and place 2 drops on the first 2 centered drops
4.) Place 2 drops of diluted sample on top of the SYBR GREEN 1 drop
5.) Align light through drop
6.) Take pictures using light box
7.) Repeat for each sample.
8.) Run water as BLANK using same procedure

ImageJ Instructions
1.) Open ImageJ
2.) Click ANALYZE tool bar and select SET MEASUREMENTS
3.) Select AREA, MEAN GREY VALUE, and INTEGRATED DENSITY
4.) Upload image to ImageJ
5.) Select IMAGE then COLOR and then SPLIT CHANNELS
6.) Only use green channel
7.) Use OVAL tool and select the entire drop of liquid
8.) Go to ANALYZE and then MEASURE
9.) Drag circle to the background of the image
10.) Record results
11.) Repeat if necessary

Research and Development

Background on Disease Markers

The single nucleotide polymorphism (SNP), 137852571, that is being examined in this experiment is linked with androgen insensitivity syndrome, and Kennedy spinal and bulbar muscular atrophy. Androgen insensitivity syndrome is when a person who is genetically male (who has one X and one Y chromosome) is resistant to male hormones (called androgens). As a result, the person has some or all of the physical traits of a woman, but the genetic makeup of a man. The mutation on the X chromosome makes the body unable to respond to the hormones that produce a male appearance. Kennedy spinal and bulbar muscular atrophy is a debilitating neurodegenerative disease resulting in muscle cramps and progressive weakness due to degeneration of motor neurons in the brain stem and spinal cord. The SNP is located on the X chromosome and affects the gene AR, the gene is inherited in an x-linked recessive manner therefore only males can be fully affected by the mutation and females are rarely affected. The sequence of this gene is:
CTTCTCCAGGCTTCCGCAACTTACAC[A/G]TGGACGACCAGATGGCTGTCATTCA
The error in this sequence is represented by [A/G] which means that the normal G base pair has been mutated into an A base pair resulting in an allele that expresses the linked diseases.


Breast Cancer
rs137852571
AR – Reverse Primer:
SNP:5,255,325
Missense GTG→ATG
V[Val]→M[Met]
Chromosome X



Primer Design


Normal: G mutates into cancer A
CAACTTACACATGGACGACC

reverse primer:
GTTGAATGTGTACCTGCAGG

Forward primer starts at 5,255,175:
AGGGGTGGTGGGGAATTACC

Illustration