BME103:T930 Group 1

From OpenWetWare
Jump to navigationJump to search
The printable version is no longer supported and may have rendering errors. Please update your browser bookmarks and please use the default browser print function instead.
BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Error creating thumbnail: File missing
Joseph Heath:
Research & Development Scientist
Error creating thumbnail: File missing
Jessica Kemper:
Experimental Protocol Planner
Error creating thumbnail: File missing
Maile Ravenkamp:
Experimental Protocol Planner
Error creating thumbnail: File missing
Nick Hool:
PCR Machine Engineer
Error creating thumbnail: File missing
Christian Boden:
PCR Machine Engineer

LAB 1 WRITE-UP

(Please finish by 11/7/2012)

Initial Machine Testing

The Original Design
Write a paragraph description for visitors who have no idea what this is)


Experimenting With the Connections

When we unplugged the mounting plate from the open PCR circuit board, the display screen on the PCR box did not work.

When we unplugged the white wire that connects the open PCR circuit board to the heating block, there was no temperature reading on the display screen.


Test Run

(First Open PCR test: 10/25/12. We had a successful and simple run of PCR)




Protocols

Polymerase Chain Reaction

Error creating thumbnail: File missing
Reagents and volumes used in PCR replication

Flourimeter Measurements

(Add your work from Week 3, Part 2 here)




Research and Development

Specific Cancer Marker Detection - The Underlying Technology

The r17879961 cancer-associated sequence (AAACTCTTACACTGCATACA) will produce a DNA signal because of its nucleotide variation (ACATTGC to ACACTGC). This T-C change results in an isoleucene to threonine substitution. In a study in Finland, patients with colorectal cancer (CRC), the most common cancer associated with the DNA sequence change, had the allele 7.8% of the time while patients without CRC had the allele in 5.3% of patients, showing a significantly higher association in CRC patients.[1] PCR detection will only give a signal if this allele is present.



Results

(Your group will add the results of your Fluorimeter measurements from Week 4 here)