Name: Tyler Allen PCR Machine Engineer, Graphic Designer
Name: Khalil Pathan Experimental Protocol Planner
Name: Pahul Singh Experimental Protocol Planner
Name: Frea Mehta Research and Development Specialist
Name: Paul Song Research and Development Specialist
LAB 2 WRITE-UP
Thermal Cycler Engineering
Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
System Design
While the system proved to be useful in previous experiments, many setbacks occurred due to the physical restraints of the devise. The overall design had many advantages (i.e. low cost, portable, simple assembly) but small parts of the system needed adjustments in order to operate on an acceptable level. Troubles we encountered included a long wait time for the system to cool to the necessary temperatures, difficulty opening the latch for the lid, and the restrictive sample size.
The heating block on the machine only allowed for 16 vials to be tested at a time. For our purposes in the previous lab, this proved to be enough but this may not be the case in other experiments. However to increase the sample size dramatically, a larger heating block, heat sink, and housing would be required. It was necessary to compromise by adding a marginal amount to the sample size in order to keep the important aspects of the original design. By arranging the blocks in a more hexagonal pattern, this allowed two additional vials without any external changes. This design maintains the same distance between each vial as the original so the heating can occur at the same rate.
While the addition of more fans could cool the system faster, this would add cost as well as complicate the assembly process. The simpler solution we found was to increase the amount of ventilation surrounding the heat sink. This is achieved by adding vents to the front and back housing panels like those on the side. While there was no noticeable problems with the circuit overheating, it was still a concern due to the high temperatures the devise reaches. The added vents will allow more hot air to be diverted from the circuitry.
Though it seemed to be a trivial problem at first, the original latch for the device's lid proved to be extremely difficult to open. Repeated use indicated that this could lead to damage to the lid hinge from the amount of force required to open it. It was also within possibility to spill or tip the vials in the machine from an over-zealous opening of the lid. The latch could easily be replaced with a magnetic latch to eliminate these problems.
Key Features
Uh... doesn't cost more money?
No new assembly instructions?
Instructions
Protocols
Materials
Supplied in the Kit
Amount
Open PCR
1
Primers
USB Cable
1
Standardized Mat with Measurements
1
Fluorimeter
1
Phone Holder
1
Light Box
1
Hydrophobic Glass slides
3
Positive Control DNA
5 mL
SYBR Gene Dye
5.2 mL
Supplied by User
Amount
Micropipettes
1
Micropipette tips
200
Lab Coats
2
Template DNA
3.3 μL
Smart Phone(with Camera)
1
PCR Protocol
DNA Measurement Protocol
Research and Development
An anencephalactic fetusAlzheimer's Disease
Background on Disease Markers
The two diseases we decided to analyze are Alzheimer's and Anencephaly. Alzheimer's disease is a form of dementia that affects the brain by gradually deteriorating an individual's brain function, leading to memory loss and impairing cognitive skills. The gene responsible for Alzheimer's is labeled PSEN1 and a mutation in this gene can cause toxic protein to build up in the brain leading to symptoms described above. The gene is found on chromosome 14 and the SNP reference number for this gene is rs63751320. The sequence for SNP is GCTCATCTTGGCTGTGATTTCAGTAT[A/C]TGGTAAAACCCAAGACTGATAATTT. For more information on this gene can be found on this link. [1]
Anencephaly is a relatively common neural tube defect that occurs during early fetal development; it causes parts of the brain and skull to not develop and results in fetal mortality in almost all cases. Although most occurrences of anencephaly are attributed to environmental toxins or low folic acid intake during pregnancy [2], but has also been affiliated with Meckel syndrome, a rare genetic disorder that affects the RPGRIP1L gene [3]. The most severe phenotypes of Meckel syndrome are present with complete inactivation of the RPGRIP1L gene. The disease is a Finnish heritage disease, with an incidence of 1.1 defects per 10,000 births as opposed to the general rate of incidence of 0.2 defects per 10,000 births [4].
The SNP associated with Meckel syndrome is rs121918202, the gene sequence for this SNP is
The disease allele, in this case C, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product.
Anencephaly :
Alleles: [C/T]
Forward Primer:
TAATATGTAATTTTATTTTCATTTTAGCTG
Reverse Primer:
GTTAATTTTCTAAATCATTAATTCTATCCT
The disease allele, in this case T, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product.
Illustration
Bayes Analysis of Anencephaly
P(A│B)= (P(B│A)P(A))/P(B)
Where P(A|B) is the probability that Meckel syndrome will occur given a positive PCR test result (a T present instead of a C in the SNP), P(B|A) is the probability that a Meckel fetus will test positive for the disease, P(A) is the probability of having the Meckel syndrome mutation, and P(B) is the probability of people without the Meckel mutation that yield positive results.