BME103:W930 Group1: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 140: Line 140:
'''Specific Cancer Marker Detection - The Underlying Technology'''<br>
'''Specific Cancer Marker Detection - The Underlying Technology'''<br>


(Add a write-up of the information discussed in Week 3's class)<br>
The primer sequence of the single nucleotide polymorphism (SNP) that is linked to colorectal cancer is GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCAGAGTGGC. The gene being affected is CHK2 (checkpoint kinase 2). The allele change is from T to C, which signifies the cancer sequence. The cancer sequence-binding primer, or the reverse primer is AACTCTACA[C]TGCATACAT. The coordinate of the cancer base pair "C" is 29,121,087. 20 base pairs (bp) to the left of the cancer sequence was TA, which occurred at coordinate 29,121,067.<br>
 
Baye's reasoning and statistical formulas can be applied to find the link between the development of cancer and the presence of the cancer gene. In a sample size of 180 patients, 1.1% of contained a single copy of the colorectal cancer (CRC) gene in their DNA (C/T) and 98.9% had no copy of the cancer gene (T/T). According to Baye's rule, the probability of having cancer and also expressing the "C" cancer gene is 1.1% when the probability of expressing the "C" gene and also having cancer is 7.8%, the probability of having cancer is unknown, and standard probability of having cancer over the population is 5.3%. Therefore, the probability of having cancer with the "C" gene is 0.74%.


(BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)
(BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)

Revision as of 18:15, 7 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Name: Kevin Chu
Experimental Protocol Planner
Name: Michael Dennison
Experimental Protocol Planner
Name: Zhiyue Yang
Machine Engineer
Name: Student
Role(s)
Name: Student
Role(s)

LAB 1 WRITE-UP

(Please finish by 11/7/2012)

Initial Machine Testing

The Original Design
)
Original design of the Open PCR machine showing inner mechanisms. While it is portable and easy to use, the design is fragile and has a high failure rate, along with several other design flaws.

Experimenting With the Connections

When we unplugged part LCD screen from the circuit board, the machine's screen stopped displaying.

When we unplugged the white wire that connects the circuit board to the heated lid, the machine stopped controlling the temperature.


Test Run

During our first test run on October 24, 2012, the machine's fan would not work and therefore we could not complete the DNA replication.




Protocols

Polymerase Chain Reaction

How PCR Works
Polymerase chain reaction (PCR) is a process that amplifies minute quantities of DNA in order to obtain a sufficient number of samples for analysis. DNA is a useful health marker and can predict the likelihood that a patient has cancer. During PCR, the double helix structure is unzipped to expose the bases. DNA primer is added to the DNA solution and binds to the gene that causes cancer. Because a non-cancer gene has a different nucleotide sequence from the cancer gene, the primer will not be able to attach to the exposed bases, so the DNA cannot be amplified. DNA amplification involves a sequence of steps called thermal cycling.

Thermal Cycling
1. To separate complementary base pairs, the sample was heated at 95°C for two minutes.
2. During annealing, the temperature was decreased to 57°C to allow the specific primers to attach. This step usually lasts between 30 seconds and one minute.
3. During extension, the temperature is increased to 72°C for one minute to allow Taq DNA polymerase to bind deoxynucleoside triphosphates (dNTPs) on the template DNA, lengthening the synthetic strand.
4. To obtain a sufficient number of samples, the process was repeated 30 times.

Components of the PCR master mix

• 2X Colorless Go Taq ® Reaction Buffer (pH 8.5)
• 400μM dATP
• 400μM dGTP
• 400μM dCTP
• 400μM dTTP
• 3mM MgCl2


Reagent Volume
Template DNA (20 ng) 0.1μL
10μM forward primer 0.5μL
10μM reverse primer 0.5μL
GoTaq master mix 25.0μL
dH2O 23.9μL
Total Volume 50.0μL

Positive Control
Cancer DNA template

Negative Control
DNA Template

Patient 1
Replicate 1
ID: 92336
Gender: Male
Age: 58

Patient 1
Replicate 2
ID: 92336
Gender: Male
Age: 58

Patient 1
Replicate 3
ID: 92336
Gender: Male
Age: 58

Patient 2
Replicate 1
ID: 44606
Gender: Male
Age: 47

Patient 2
Replicate 2
ID: 44606
Gender: Male
Age: 47

Patient 2
Replicate 3
ID: 44606
Gender: Male
Age: 47



Flourimeter Measurements

Insert image here




Research and Development

Specific Cancer Marker Detection - The Underlying Technology

The primer sequence of the single nucleotide polymorphism (SNP) that is linked to colorectal cancer is GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCAGAGTGGC. The gene being affected is CHK2 (checkpoint kinase 2). The allele change is from T to C, which signifies the cancer sequence. The cancer sequence-binding primer, or the reverse primer is AACTCTACA[C]TGCATACAT. The coordinate of the cancer base pair "C" is 29,121,087. 20 base pairs (bp) to the left of the cancer sequence was TA, which occurred at coordinate 29,121,067.

Baye's reasoning and statistical formulas can be applied to find the link between the development of cancer and the presence of the cancer gene. In a sample size of 180 patients, 1.1% of contained a single copy of the colorectal cancer (CRC) gene in their DNA (C/T) and 98.9% had no copy of the cancer gene (T/T). According to Baye's rule, the probability of having cancer and also expressing the "C" cancer gene is 1.1% when the probability of expressing the "C" gene and also having cancer is 7.8%, the probability of having cancer is unknown, and standard probability of having cancer over the population is 5.3%. Therefore, the probability of having cancer with the "C" gene is 0.74%.

(BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)




Results

(Your group will add the results of your Fluorimeter measurements from Week 4 here)