IGEM:Peking University/2008/Experiment/PKU 0620 G2 1: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Yue Zhao (talk | contribs)
No edit summary
Yue Zhao (talk | contribs)
No edit summary
Line 52: Line 52:




::'''Enzyme cutting-DNA (pGREG503/504)-SacI-XhoI-20 μL'''
::'''Enzyme cutting-pPT1-XbaI-20 μL'''
{|align="right"
 
[[Image:PKU_080513_pGREG504-cut.tif|400px]]
|}
{|border="1" cellspacing="0"  
{|border="1" cellspacing="0"  
|+  
|+  
Line 61: Line 59:
| ||Volumn(μL)  
| ||Volumn(μL)  
|-  
|-  
| pGREG503/504 ||5
| plasmid||5
|-  
|-  
| SacI||0.2
| XbaI||0.2
|-  
|-  
| XhoI ||0.2||*5
| BSA ||2
|-
|-
| M Buffer||2
| M Buffer||2
|-
|-
|ddH<sub>2</sub>O||12.6
|ddH<sub>2</sub>O||10.8
|}
|}
{|align="right"
{|align="right"
|back to [[PKU_Experiment|Previous Page]]
|back to [[PKU_Experiment|Previous Page]]
|}
|}

Revision as of 12:22, 4 July 2008

Primer design

Primer 1
  • Primer name: F-HindIII-Apal-Gal4
  • Sequence(5'to3'):CCCAAGCTTGGGCCCAAGATGAAGCTACTGTCTTCTATCGAACAA
  • Tm:64.9°C
Primer 2
  • Primer name: R-EcoRI-Spel-Gal4
  • Sequence(5'to3'):GGGGAATTCACTAGTATTTTACTCTTTTTTTGGGTTTGGTGGGGT
  • Tm:61.3°C


PCR

TITLE: PCR-Budding Yeast Genome-Gal4-phusion polymerase 50*6ul
Volume (μL)
Template (pPT1) 0.5
dNTP 1
Enzyme 0.5
Buffer 10
F-HindIII-Apal-Gal4 0.5
R-EcoRI-Spel-Gal4 0.5
ddH2O 37
conditions
Temperature Time Length(0:00:00)
98°C 00:30
98°C 00:10 30 cycles
57.1,60.4,62.5,64.7,66.9,68.9°C 00:30 30 cycles
72°C 01:30 30 cycles
72°C 07:00
4°C Hold


Enzyme cutting-pPT1-XbaI-20 μL
Volumn(μL)
plasmid 5
XbaI 0.2
BSA 2
M Buffer 2
ddH2O 10.8
back to Previous Page