BME103:T930 Group 10 l2: Difference between revisions
| (44 intermediate revisions by 5 users not shown) | |||
| Line 12: | Line 12: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- | |- valign="top" | ||
| [[Image:BME103student.jpg|100px|thumb|Name: | | [[Image:BME103student.jpg|100px|thumb|Name: Nolan Bidese<br>Role: Research and Development]] | ||
| [[Image:BME103student.jpg|100px|thumb|Name: | | [[Image:BME103student.jpg|100px|thumb|Name: Evan Austin<br>Role: Open PCR Thermal Cycler Engineer]] | ||
| [[Image: | | [[Image:Meeeeeeee.jpg|100px|thumb|Name: Aldin Malkoc <br>Role: Open PCR Thermal Cycler Engineer]] | ||
| [[Image:BME103_Group10_MikayleHolm.jpg|100px|thumb|Name: Mikayle Holm <br>Role: Experimental Protocol Planner]] | | [[Image:BME103_Group10_MikayleHolm.jpg|100px|thumb|Name: Mikayle Holm <br>Role: Experimental Protocol Planner]] | ||
| [[Image: | | [[Image:BME103_Group10_Coleen.CF.jpg|100px|thumb|Name: Coleen Fox <br>Role: Experimental Protocol Planner]] | ||
|} | |} | ||
| Line 29: | Line 29: | ||
'''System Design'''<br> | '''System Design'''<br> | ||
[[Image:Magnet_Lid.PNG|600px|Lid with highlighted area for magnets]] | |||
[[Image: Hinge_Lid.PNG|600px|Lid with highlighted area for magnets]] | |||
[[Image: Side Panel Lid.PNG|600px|Lid with highlighted area for magnets]] | |||
'''Key Features'''<br> | |||
After using the Open PCR machine, we noticed a few components of the machine that could be improved. The biggest issue we encountered was that of the lid. When placing the tubes into the machine, it was very difficult to unlatch the lid from the base. Additionally, when screwing the heating plate down onto the tubes, it was difficult to tell how much the plate needed to be screwed down. With these problems in mind, we decided to redesign the lid by replacing two of the panels of the lid with plexi-glass and replace the hinge with magnets. By replacing two of the panels with plexi-glass, the user is able to see the heating plate being screwed down onto the tubes. This ensures that proper placement and rids of possible experimental errors. By replacing the hinge with magnets, we eliminate the difficulty experienced with the hinge. Also, placing magnets at the corners of the lid to hold the lid in place allows for greater visibility when adding the tubes to the tray. | |||
'''Instructions'''<br> | |||
'''Assembly Instructions ''' | |||
1. Same procedure following up until lid. | |||
''2. There will be no latch'' | |||
3. Screw in four magnets on machine top and lid at corners. | |||
''4. This will secure lid down to machine.'' | |||
5. Follow instructions to adding side panels to lid with exceptions. | |||
6. ''Exception'': Replace two opposite sides on lid with plexi-glass | |||
'''User Instructions''' | |||
1. Follow all user Instructions with exception. | |||
2. ''Exception 1'': Lid can now come off entirely due to magnetic screws. | |||
''' | ''3. Will make it easier to adding vial tubes.'' | ||
4. ''Exception 2'': Use plexi-glass to see how much to screw down the heating pad. | |||
''5. Will ensure proper fit of heating lid.'' | |||
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
| Line 65: | Line 95: | ||
| align="center"style="background:#f0f0f0;"|'''Volume''' | | align="center"style="background:#f0f0f0;"|'''Volume''' | ||
|- | |- | ||
| PCR Reaction Mix(a.k.a. GoTaq Mix)|| | | *PCR Reaction Mix (a.k.a. GoTaq Mix)|| Amount in kit enough for given experiment | ||
|- | |- | ||
| align="center"style="background:#f0f0f0;"|'''DNA Samples''' | | align="center"style="background:#f0f0f0;"|'''DNA Samples''' | ||
| Line 78: | Line 104: | ||
| Negative control||Positive Control | | Negative control||Positive Control | ||
|- | |- | ||
| SYBR GREEN1|| | | SYBR GREEN1|| | ||
|} | |} | ||
*mix includes Taq DNA Polymerase, MgCl2, dNTP's, Forward and Reverse Primers<br> | |||
{| {{table}} | {| {{table}} | ||
| Line 87: | Line 114: | ||
| Lab Coat||1 or 2 | | Lab Coat||1 or 2 | ||
|- | |- | ||
| PCR machine made of steel with top that snaps||must clip | | PCR machine made of steel with top that snaps||PCR machine must clip closed | ||
|- | |- | ||
| Fluorimeter with built in camera and slides with dots farther apart||12 new glass slides | | Fluorimeter with built in camera and slides with dots farther apart||12 new glass slides | ||
|- | |- | ||
| | | Micropipettes||1 box, allow extras for mistakes | ||
|- | |- | ||
| Eppendorf tubes|| | | Eppendorf tubes||1 box, at least one for each test | ||
|} | |} | ||
| Line 139: | Line 166: | ||
| 17||Patient 5, Replicate 3 | | 17||Patient 5, Replicate 3 | ||
|} | |} | ||
[[Image:BME103_Group10_Eppendorf.jpg|400px|Flickr photo by Clss1cr0ck3R]] | |||
2. Use properly labeled micropipette to place 17 samples into 17 properly labeled Eppendorf tubes already containing 50 microliters GoTaq mix. To see contents of GoTaq mix, see materials.<br> | 2. Use properly labeled micropipette to place 17 samples into 17 properly labeled Eppendorf tubes already containing 50 microliters GoTaq mix. To see contents of GoTaq mix, see materials.<br> | ||
| Line 169: | Line 198: | ||
'''Background on Disease Markers''' | '''Background on Disease Markers''' | ||
The prostate is a gland in the male reproductive system located just below the bladder. It is about the size of a walnut and surrounds part of the urethra. The prostate gland helps to control urinary and sexual functions that are associated with the reproductive system.[http://www.cancer.gov/cancertopics/pdq/treatment/prostate/Patient] Risk Factors for prostate cancer are age, race, and family genetics of prostate cancer. The marker being used is rs137852593 [http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=137852593] This SNP is associated with a defect in a protein in the prostate that may or may not cause cancer in the prostate. It is located on the X chromosome and the mutated protein goes from R [Arg] ⇒ L [Leu]. | |||
Leukemia is a type of cancer that affects the blood and bone marrow. The disease develops when blood cells produced in the bone marrow grow out of control. An estimated 44,600 new cases of leukemia are expected to be diagnosed in the United States in 2011. [http://www.lls.org/#/diseaseinformation/leukemia/] The marker being used for this is rs111033629.[http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=111033629] The SNP is associated with a defect in a protein in bone marrow. It is located on the X chromosome and the mutated protein goes from M [Met] ⇒ I [Ile]. | |||
| Line 177: | Line 206: | ||
<!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | <!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---> | ||
5'ACAAAGGAAAAAGTTCT'''ATT'''TC3' | |||
ATG ⇒ ATT The change in mutated protein | |||
Reverse Primer: TGTTTCCTTTTTCAAGATAAAG | |||
5'CAACTTACACTGGACGTCCAGA3' | |||
CGC ⇒ CTC change in the mutated protein | |||
Reverse Primer: GTTGAATGTGACCTGCAGGTCT | |||
'''Illustration''' | '''Illustration''' | ||
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | ||
[[Image:SNP.jpg]] | |||
[http://www.sciencedirect.com/science/article/pii/S0167701206002247] | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} | ||
Latest revision as of 01:45, 30 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
2. There will be no latch 3. Screw in four magnets on machine top and lid at corners. 4. This will secure lid down to machine. 5. Follow instructions to adding side panels to lid with exceptions. 6. Exception: Replace two opposite sides on lid with plexi-glass
2. Exception 1: Lid can now come off entirely due to magnetic screws. 3. Will make it easier to adding vial tubes. 4. Exception 2: Use plexi-glass to see how much to screw down the heating pad. 5. Will ensure proper fit of heating lid.
ProtocolsMaterials For PCR Protocol
1. Label Eppendorf Tubes with 1-17. Each tube should contain 50 microliters of one of the following substances:
2. Use properly labeled micropipette to place 17 samples into 17 properly labeled Eppendorf tubes already containing 50 microliters GoTaq mix. To see contents of GoTaq mix, see materials. DNA Measurement Protocol 1. With permanent marker, clearly number micropipettes. With permanent marker, number Eppendorf tubes at the top. There should be 17 labeled micropipettes and 17 Eppendorf tubes. Research and DevelopmentBackground on Disease Markers The prostate is a gland in the male reproductive system located just below the bladder. It is about the size of a walnut and surrounds part of the urethra. The prostate gland helps to control urinary and sexual functions that are associated with the reproductive system.[1] Risk Factors for prostate cancer are age, race, and family genetics of prostate cancer. The marker being used is rs137852593 [2] This SNP is associated with a defect in a protein in the prostate that may or may not cause cancer in the prostate. It is located on the X chromosome and the mutated protein goes from R [Arg] ⇒ L [Leu]. Leukemia is a type of cancer that affects the blood and bone marrow. The disease develops when blood cells produced in the bone marrow grow out of control. An estimated 44,600 new cases of leukemia are expected to be diagnosed in the United States in 2011. [3] The marker being used for this is rs111033629.[4] The SNP is associated with a defect in a protein in bone marrow. It is located on the X chromosome and the mutated protein goes from M [Met] ⇒ I [Ile].
5'ACAAAGGAAAAAGTTCTATTTC3' ATG ⇒ ATT The change in mutated protein Reverse Primer: TGTTTCCTTTTTCAAGATAAAG 5'CAACTTACACTGGACGTCCAGA3' CGC ⇒ CTC change in the mutated protein Reverse Primer: GTTGAATGTGACCTGCAGGTCT Illustration | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




