Biomod/2013/Sendai/protocol: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
 
(21 intermediate revisions by 2 users not shown)
Line 53: Line 53:
<ul>
<ul>
<li class="toclevel-1"><a href="#chain">
<li class="toclevel-1"><a href="#chain">
<span class="tocnumber">1</span> <span class="toctext">1st stage: Sensing system</span></a></li>
<span class="tocnumber">1</span> <span class="toctext">First stage: Sensing system</span></a></li>
<ul>
<ul>
<li class="toclevel-2"><a href="#bending">
<li class="toclevel-2"><a href="#bending">
Line 59: Line 59:
</ul>
</ul>
<li class="toclevel-1"><a href="#Flower">
<li class="toclevel-1"><a href="#Flower">
<span class="tocnumber">2</span> <span class="toctext">2nd stage: Amplification system</span></a></li>
<span class="tocnumber">2</span> <span class="toctext">Second stage: Amplification system</span></a></li>
<ul>
<ul>
<li class="toclevel-2"><a href="#sensing">
<li class="toclevel-2"><a href="#sensing">
Line 95: Line 95:
</td></tr></table>
</td></tr></table>


<h3 id=chain>1 Step1 Disruption of temperature sensitive liposomes</h3>
<h3 id=chain>First stage: Sensing system </h3>
<h4 id=bending>1-1 Disruption of temperature sensitive liposomes</h4>
<h4 id=bending>1-1 Disruption of temperature sensitive liposomes</h4>
<h5> Structure of NIPAM</h5>
<h5> Structure of NIPAM</h5><br>
<img src="http://openwetware.org/images/f/f5/Nipam.png"width="180"height="210"><br>
<img src="http://openwetware.org/images/f/f5/Nipam.png"width="180"height="210"><br>
poly-N-isopropyl acrylamide
poly-N-isopropyl acrylamide<br>
<h5> Making liposome</h5>
<h5> Making liposome</h5>
<table border cellspacing="3" bgcolor="lightyellow">
<table border cellspacing="3" bgcolor="lightyellow">
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> Egg York PC(10mM)</td>
<td> Egg York PC(10mM)</td>
<td> 10µl
<td> 10µL
</td>
</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> Cholesterol(10mM)</td>
<td> Cholesterol(10mM)</td>
<td> 1µl</td>
<td> 1µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> CHCl<sub>3</sub></td>
<td> CHCl<sub>3</sub></td>
<td> 90µl</td>
<td> 90µL</td>
</tr>
<tr bgcolor="moccasin">
<td> TXR</td>
<td> 1µl </td>
</tr>
</tr>
</table>
</table>
Table1 Materials for Making liposomes<br><br>
<div class="captiontable">
Table1 Materials for liposome preparation<br><br>
</div>
 
1. Egg york PC and cholesterol solution was mixed and put on a glass tube.<br>
2. To create a dried lipid film, the lipid solution was put on a glass tube then The solution was dried by argon gas and then in vacuum for a night. <br>
3. Adding the pure water onto the dried lipid film to obtaining the giant liposomes.<br>
4. The liposome solution 10µL was gently mixed with 25μl NIPAM solution (2mg/ml in the pure water).<br>
 


1. Drying the liposomes above with argon gas and letting them stand for a night<br>
<h3 id=Flower>Second stage: Amplification system</h5>
2. Adding L paraffin 100µl to 1 and sonicating them for an hour<br>
3. Picking up 10µl from 2, adding 25μl NIPAM2mg/ml to them and vibrating them with Vortex<br>
<h3 id=Flower>2 Step2 Liposome disruption induced by attachment of key DNA with anchor DNA</h5>
<h4 id=sensing>2-1 DNA Origami approach</h4>
<h4 id=sensing>2-1 DNA Origami approach</h4>
<h5 id=5>2-1-1 Making DNA Origami</h5>
<h5 id=5>2-1-1 Making DNA Origami</h5>
Line 131: Line 132:
<h6>DNA origami recipe</h6>
<h6>DNA origami recipe</h6>
We designed DNA origami by <A Href="http://cadnano.org/">caDNAno2</A>, software for designing 2D and 3D DNA origami.<br>
We designed DNA origami by <A Href="http://cadnano.org/">caDNAno2</A>, software for designing 2D and 3D DNA origami.<br>
Our DNA origami has 141 staples that have 30nt free single-stranded parts outside the DNA origami. The sequence of the parts is <i>“<font color="#00a0c0">each DNA origami staple</font>-TTTTTTTTTTTTTTT<font color="red">CTGTCGCATCGAGAG</font>”</i>.<br>
Our DNA origami has 141 staples that have 30nt free single-stranded parts outside the DNA origami. The sequence of the parts is “<font color="#00a0c0">each DNA origami staple</font>-TTTTTTTTTTTTTTT<font color="red">CTGTCGCATCGAGAG</font>”.<br>
Between the staple and unique (<i><font color="red">CTGTCGCATCGAGAG</font></i>) sequences, 15 T bases are inserted. They are to make a T loop. Thanks to this T loop, single-stranded DNA complementary to the unique sequences (such as Origami-anchor DNA) are expected to easily hybridize with the unique sequence.<br>
Between the staple and unique (<font color="red">CTGTCGCATCGAGAG</font>) sequences, 15 T bases are inserted. They are to make a T loop. Thanks to this T loop, single-stranded DNA complementary to the unique sequences (such as Origami-anchor DNA) are expected to easily hybridize with the unique sequence.<br>
The 30nt single-stranded parts are stable till 37 degrees, according to <A Href="http://www.nupack.org/">NUPACK</A>).<br>
The 30nt single-stranded parts are stable till 37°C, according to <A Href="http://www.nupack.org/">NUPACK</A>).<br>
The 141 staples have the same length so that they may be present at the same intervals in the DNA origami.<br>
The 141 staples have the same length so that they may be present at the same intervals in the DNA origami.<br>
Each side of our origami is not fully covered with staples, and single-stranded M13 remains. This is for preventing π-π interaction and stacking by hydrophobic interaction between base pairs of double-stranded DNA.<br>
Each side of our origami is not fully covered with staples, and single-stranded M13 remains. This is for preventing π-π interaction and stacking by hydrophobic interaction between base pairs of double-stranded DNA.<br>
Line 166: Line 167:
</tr>
</tr>
</table>
</table>
Table2 The sequence of the strands<br>
<div class="captiontable">Table2 The sequence of the strands</div><br>
<br>
<br>
<h6>Annealing of DNA origami</h6>
<h6>Annealing of DNA origami</h6>
The annealing solution is shown in Table3. The annealing was conducted for 2 hours and 51minutes (from 95 to 25 degrees: lower 1 degree per 2 minutes).<br>
The annealing solution is shown in Table3. The annealing was conducted for 2 hours and 51minutes (from 95 to 25°C: lower 1°C per 2 minutes).<br>
<br>
<br>
<ur><li>Annealing solution with fluorescent-tagged DNA 50µl<br>
<ur><li>Annealing solution with fluorescent-tagged DNA 50µL<br>
<table border cellspacing="3" bgcolor="lightyellow">
<table border cellspacing="3" bgcolor="lightyellow">
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>84nM M13mp18</td>
<td>84nM M13mp18</td>
<td>2.38µl</td>
<td>2.4µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
Line 183: Line 184:
<tr>
<tr>
<td>1µM migihaji</td>
<td>1µM migihaji</td>
<td>1µl</td>
<td>1µL</td>
</tr>
</tr>
<tr>
<tr>
<td>1µM hidarihaji</td>
<td>1µM hidarihaji</td>
<td>1µl</td>
<td>1µL</td>
</tr>
</tr>
<tr>
<tr>
<td>1µM ashibatemae</td>
<td>1µM ashibatemae</td>
<td>1µl</td>
<td>1µL</td>
</tr>
</tr>
<tr>
<tr>
<td>200nM ashiba</td>
<td>200nM ashiba</td>
<td>5µl</td>
<td>5µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>1µM cholesterol-hybridizing ssDNA</td>
<td>1µM cholesterol-hybridizing ssDNA</td>
<td>3µl</td>
<td>3µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>1µM fluorescent-tagged DNA-hybridizing ssDNA</td>
<td>1µM fluorescent-tagged DNA-hybridizing ssDNA</td>
<td>3µl</td>
<td>3µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>5xTAE Mg2+</td>
<td>5xTAE Mg<sup>2+</sup></td>
<td>10µl</td>
<td>10µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>mQ</td>
<td>mQ</td>
<td>20.62µl</td>
<td>20.6µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
Line 219: Line 220:
</table>
</table>
</li>
</li>
Table3 Annealing solution with fluorescent-tagged DNA<br>
<div class="captiontable">Table3 Annealing solution with fluorescent-tagged DNA</div><br>
<br>
<br>
<li>Annealing solution with no fluorescent-tagged DNA (control) 50µl<br>
<li>Annealing solution with no fluorescent-tagged DNA (control) 50µL<br>
We changed 3µl fluorescent-tagged DNA in the above solution into the same quantity of mQ.</li><br>
We changed 3µL fluorescent-tagged DNA in the above solution into the same quantity of mQ.</li><br>
<br>
<br>
<h5 id=6>2-1-2 Labeling DNA Origami with fluorescent-tagged DNA</h5>
<h5 id=6>2-1-2 Labeling DNA Origami with fluorescent-tagged DNA</h5>
Line 228: Line 229:
We confirmed that our DNA origami was fluorescently labeled by electrophoresis.<br>
We confirmed that our DNA origami was fluorescently labeled by electrophoresis.<br>
<br>
<br>
50µl of Annealing solution with fluorescent-tagged DNA (used in 2-1-1 Making DNA origami) contains 3µl of 1µM fluorescent-tagged DNA. <br>
50µL of Annealing solution with fluorescent-tagged DNA (used in 2-1-1 Making DNA origami) contains 3µL of 1µM fluorescent-tagged DNA. <br>
To see if the origami binds to the fluorescent-tagged DNA in shorter time, we added 0.6µl of 1µM fluorescent-tagged DNA into 10 µl control annealing solution, and left it for 40 minutes.<br>
To see if the origami binds to the fluorescent-tagged DNA in shorter time, we added 0.6µL of 1µM fluorescent-tagged DNA into 10 µL control annealing solution, and left it for 40 minutes.<br>
<br>
<br>
Agarose gel recipe: 0.4g agarose, 0.8ml 50xTAE, 39.2ml mQ<br>
Agarose gel recipe: 0.4g agarose, 0.8ml 50xTAE, 39.2ml mQ<br>
Line 238: Line 239:
<h5> Making liposome</h5>
<h5> Making liposome</h5>
1. Drying the liposomes below with argon gas and letting them stand for a night<br>
1. Drying the liposomes below with argon gas and letting them stand for a night<br>
2. Adding 1xTAE Mg2+ 100µl to 1 and heating it in warm water (about 90 deg C) for a few hours<br><br>
2. Adding 1xTAE Mg<sup>2+</sup> 100µL to 1 and heating it in warm water (about 90 deg C) for a few hours<br><br>
<table border cellspacing="3" bgcolor="lightyellow">
<table border cellspacing="3" bgcolor="lightyellow">
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> DOPC (10mM)</td>
<td> DOPC (10mM)</td>
<td> 1µl
<td> 1µL
</td>
</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> CHCl3</td>
<td> CHCl<sub>3</sub></td>
<td> 99µl</td>
<td> 99µL</td>
</tr>
</tr>
</table>
</table>
Table4 Materials for Making liposomes<br><br>
<div class="captiontable">Table4 Materials for Making liposomes</div><br><br>
<h5>Concentration of Origami-anchor DNA</h5>
<h5>Concentration of Origami-anchor DNA</h5>
To float Origami-anchor DNA on the surface of liposome, we added Origami-anchor DNA into liposomes at the final concentration of 0.018, 0.069, 1.8, and 6.9µM. Each sample was as follows.<br>
To float Origami-anchor DNA on the surface of liposome, we added Origami-anchor DNA into liposomes at the final concentration of 0.018, 0.069, 1.8, and 6.9µM. Each sample was as follows.<br>
<ur><li>Liposome with 0.018µM Origami-anchor DNA: 1µl 0.1µM Origami-anchor DNA and 2.5µl liposome</li>
<ur><li>Liposome with 0.018µM Origami-anchor DNA: 1µL 0.1µM Origami-anchor DNA and 2.5µL liposome</li>
<li>Liposome with 0.069µM Origami-anchor DNA: 10µl 0.1µM DNAs and 2.5µl liposome</li>
<li>Liposome with 0.069µM Origami-anchor DNA: 10µL 0.1µM DNAs and 2.5µL liposome</li>
<li>Liposome with 1.8µM Origami-anchor DNA: 1µl 10µM DNAs and 2.5µl liposome</li>
<li>Liposome with 1.8µM Origami-anchor DNA: 1µL 10µM DNAs and 2.5µL liposome</li>
<li>Liposome with 6.9µM Origami-anchor DNA: 10µl 10µM DNAs and 2.5µl liposome</li>
<li>Liposome with 6.9µM Origami-anchor DNA: 10µL 10µM DNAs and 2.5µL liposome</li>
<br>
<br>
<h5>Observation by phase and fluorescent microscope </h5>
<h5>Observation by phase and fluorescent microscope </h5>
We observed each sample with a phase microscope.<br>
We observed each sample with a phase microscope.<br>
<br>
<br>
Then we added 2µl DNA origami into each sample and saw if some change would happen with a fluorescent microscope.<br>
Then we added 2µL DNA origami into each sample and saw if some change would happen with a fluorescent microscope.<br>
The DNA origami for fluorescent microscope observation was made according to Table5 annealing solution. It contained more cholesterol-hybridizing ssDNAs and fluorescent-tagged DNA-hybridizing ssDNAs than Annealing solution used in 2-1-1, because we considered a sample with more fluorescent molecules was suitable for observation.  <br>
The DNA origami for fluorescent microscope observation was made according to Table5 annealing solution. It contained more cholesterol-hybridizing ssDNAs and fluorescent-tagged DNA-hybridizing ssDNAs than Annealing solution used in 2-1-1, because we considered a sample with more fluorescent molecules was suitable for observation.  <br>
<br>
<br>
Line 268: Line 269:
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>84nM M13mp18</td>
<td>84nM M13mp18</td>
<td>2.38µl</td>
<td>2.4µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
Line 276: Line 277:
<tr>
<tr>
<td>1µM migihaji</td>
<td>1µM migihaji</td>
<td>1µl</td>
<td>1µL</td>
</tr>
</tr>
<tr>
<tr>
<td>1µM hidarihaji</td>
<td>1µM hidarihaji</td>
<td>1µl</td>
<td>1µL</td>
</tr>
</tr>
<tr>
<tr>
<td>1µM ashibatemae</td>
<td>1µM ashibatemae</td>
<td>1µl</td>
<td>1µL</td>
</tr>
</tr>
<tr>
<tr>
<td>200nM ashiba</td>
<td>200nM ashiba</td>
<td>5µl</td>
<td>5µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>100µM cholesterol-hybridizing ssDNA</td>
<td>100µM cholesterol-hybridizing ssDNA</td>
<td>4.23µl</td>
<td>4.2µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>100µM fluorescent-tagged DNA-hybridizing ssDNA</td>
<td>100µM fluorescent-tagged DNA-hybridizing ssDNA</td>
<td>4.23µl</td>
<td>4.2µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>5xTAE Mg2+</td>
<td>5xTAE Mg<sup>2+</sup></td>
<td>10µl</td>
<td>10µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>mQ</td>
<td>mQ</td>
<td>23.54µl</td>
<td>23.5µL</td>
</tr>
</tr>
</table>
</table>


Table5 50µl Annealing solution for fluorescent microscope observation<br>
<div class="captiontable">Table5 50µL Annealing solution for fluorescent microscope observation</div><br>
<br>
<br>
After annealing, we added 4.23µl 100µM fluorescent-tagged DNA (the same quantity of fluorescent-tagged DNA-hybridizing ssDNA).<br>
After annealing, we added 4.2µL 100µM fluorescent-tagged DNA (the same quantity of fluorescent-tagged DNA-hybridizing ssDNA).<br>
<br>
<br>
<h5 id=13>2-1-4 Disruption of liposomes by DNA Origami (quantitative analysis)</h5>
<h5 id=13>2-1-4 Disruption of liposomes by DNA Origami (quantitative analysis)</h5>
<h5>Making liposome</h5>
<h5>Making liposome</h5>
 
<div class="caption-right">
Liposomes were formed by the droplet-transfer method (Pautot et al., PNAS, 2003).
<Img Src="http://openwetware.org/images/6/6d/Wo_method-%E5%AE%8C%E6%88%90%E7%89%88.png" style="padding-left:10mm"><span>Fig.4 the droplet-transfer method</span>
</div>
We make phase-separatied liposomes made of DOPC, DPPC, DOPE and cholesterol.<br>
Phase-separated liposomes are liposomes consisting of several kinds of lipids. It has less fluidity and its membranee is more stiff than normal liposomes.<br>
Due to the above reasons, we consider that phase-separated liposomes are more suitable to be disrupted. Thus, this time, we used phase-separated liposomes.<br>
Liposomes were formed by the droplet-transfer method Pautot et al., PNAS, 100, 10718-21 (2003).<br>
<br>
<table border cellspacing="3" bgcolor="lightyellow">
<table border cellspacing="3" bgcolor="lightyellow">
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> DOPC(10mM)</td>
<td> DOPC(10mM)</td>
<td> 20µl
<td> 20µL
</td>
</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> DPPC(10mM)</td>
<td> DPPC(10mM)</td>
<td> 20µl</td>
<td> 20µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> Cholesterol(10mM) </td>
<td> Cholesterol(10mM) </td>
<td> 20µl</td>
<td> 20µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> DOPE(10mM)</td>
<td> DOPE(10mM)</td>
<td> 20µl </td>
<td> 20µL </td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>chloroform</td>
<td>chloroform</td>
<td> 260µl </td>
<td> 260µL </td>
</tr>
</tr>
</table>
</table>
Table6 Materials for Making liposomes<br><br>
<div class="captiontable">Table6 Materials for Making liposomes</div><br><br>
1 Drying the liposomes above with argon gas and letting them stand for a night<br>
1 Drying the liposomes above with argon gas and letting them stand for a night<br>
2 Adding mineral oil 260µl to 1 and sonicating them (43Hz, 60 deg C, for 2 hours)<br>  
2 Adding mineral oil 260µL to 1 and sonicating them (43Hz, 60 deg C, for 2 hours)<br>  
3 Preparing 1.5ml microtube and pouring outer buffer 50µl. Then picking up 50µl from 2 and adding it on the outer buffer (softly, to make a bilayer)<br>
3 Preparing 1.5ml microtube and pouring outer buffer 50µL. Then picking up 50µL from 2 and adding it on the outer buffer (softly, to make a bilayer)<br>
<br>
<br>
<table border cellspacing="3" bgcolor="lightyellow">
<table border cellspacing="3" bgcolor="lightyellow">
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> glucose(1M)</td>
<td> glucose(1M)</td>
<td> 125µl
<td> 125µL
</td>
</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> 25xTAE Mg2+</td>
<td> 25xTAE Mg<sup>2+</sup></td>
<td> 10µl</td>
<td> 10µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> mQ </td>
<td> mQ </td>
<td> 110µl</td>
<td> 110µL</td>
</tr>
</tr>
</table> Table7 Outer Buffer (250µl)<br><br>
</table>
<div class="captiontable">Table7 Outer Buffer (250µL)</div><br><br>
<br>
<br>
4 Preparing 0.2 ml microtube and pouring inner buffer 2µl. Then picking up 50µl from 2, adding it on the inner buffer, and mixing them by tapping<br>
4 Preparing 0.2 ml microtube and pouring inner buffer 2µL. Then picking up 50µL from 2, adding it on the inner buffer, and mixing them by tapping<br>
<br>
<br>
<table border cellspacing="3" bgcolor="lightyellow">
<table border cellspacing="3" bgcolor="lightyellow">
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> GFP(0.5 mM)</td>
<td> GFP(0.5 mM)</td>
<td> 5µl
<td> 5µL
</td>
</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> sucrose(1M)</td>
<td> sucrose(1M)</td>
<td> 125µl</td>
<td> 125µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> 25xTAE Mg2+ </td>
<td> 25xTAE Mg<sup>2+</sup> </td>
<td> 10µl</td>
<td> 10µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> mQ </td>
<td> mQ </td>
<td> 110µl</td>
<td> 110µL</td>
</tr>
</tr>
</table> Table8 Inner Buffer (250µl)<br><br>
</table>
5 Pouring all the solution (52µl) of 4 into the 1.5ml tube (softly, to make a three-layer)
<div class="captiontable">Table8 Inner Buffer (250µL)</div><br><br>
5 Pouring all the solution (52µL) of 4 into the 1.5ml tube (softly, to make a three-layer)
6 Centrifuging it for 30 seconds and taking only the bottom layer<br>
6 Centrifuging it for 30 seconds and taking only the bottom layer<br>
<br>
<br>
Line 389: Line 398:
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> Liposome (with GFP inside) (4mM)</td>
<td> Liposome (with GFP inside) (4mM)</td>
<td> 10µl
<td> 10µL
</td>
</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> Origami-anchor DNA (10uM)</td>
<td> Origami-anchor DNA (10uM)</td>
<td> 25µl</td>
<td> 25µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> 1xTAE Mg2+ </td>
<td> 1xTAE Mg<sup>2+</sup></td>
<td> 75µl</td>
<td> 75µL</td>
</tr>
</tr>
</table>
</table>
Table9 Sample1: negative control<br><br>
<div class="captiontable">Table9 Sample1: negative control</div><br><br>
Sample2 is the positive control. It is the mixture of liposome, Origami-anchor DNA, and surfactant (NP40).<br>
Sample2 is the positive control. It is the mixture of liposome, Origami-anchor DNA, and surfactant (NP40).<br>
<table border cellspacing="3" bgcolor="lightyellow">
<table border cellspacing="3" bgcolor="lightyellow">
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> Liposome (with GFP inside) (4mM)</td>
<td> Liposome (with GFP inside) (4mM)</td>
<td> 10µl
<td> 10µL
</td>
</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> Origami-anchor DNA (10uM)</td>
<td> Origami-anchor DNA (10uM)</td>
<td> 25µl</td>
<td> 25µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> 1xTAE Mg2+ </td>
<td> 1xTAE Mg<sup>2+</sup></td>
<td> 75µl</td>
<td> 75µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> Surfactant (NP40)</td>
<td> Surfactant (NP40)</td>
<td> 2µl</td>
<td> 2µL</td>
</tr>
</tr>
</table>
</table>
Table10 Sample2: positive control<br><br>
<div class="captiontable">Table10 Sample2: positive control</div><br><br>
Sample3 is the mixture of liposome, Origami-anchor DNA, and Key DNA Origami.<br>
Sample3 is the mixture of liposome, Origami-anchor DNA, and Key DNA Origami.<br>
<table border cellspacing="3" bgcolor="lightyellow">
<table border cellspacing="3" bgcolor="lightyellow">
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> Liposome (with GFP inside) (4mM)</td>
<td> Liposome (with GFP inside) (4mM)</td>
<td> 10µl
<td> 10µL
</td>
</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> Origami-anchor DNA (10uM)</td>
<td> Origami-anchor DNA (10uM)</td>
<td> 25µl</td>
<td> 25µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> 1xTAE Mg2+ </td>
<td> 1xTAE Mg<sup>2+</sup> </td>
<td> 55µl</td>
<td> 55µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> Key DNA (5nM)</td>
<td> Key DNA (5nM)</td>
<td> 20µl</td>
<td> 20µL</td>
</tr>
</tr>
</table>
</table>
Table11 Sample3<br><br>
<div class="captiontable">
Table11 Sample3</div><br><br>
1. Adding Origami-anchor DNA to each sample, and leaving it for 30 minutes.<br>
1. Adding Origami-anchor DNA to each sample, and leaving it for 30 minutes.<br>
2. Adding Key DNA to each sample, and leaving it for 10 minutes.<br>
2. Adding Key DNA to each sample, and leaving it for 10 minutes.<br>
3. Taking each sample 50µl and measuring each sample’s fluorescence intensity of 7-13 µm diameter liposomes by Cell Lab Quanta SC Flow Cytometer.<br>
3. Taking each sample 50µL and measuring each sample’s fluorescence intensity of 7-13 µm diameter liposomes by Cell Lab Quanta SC Flow Cytometer.<br><br>
<br>
<h5>Image of Cell Lab Quanta SC Flow Cytometer</h5><br>
<div align="center">
<table>
<tbody>
<tr align="center">
<td>
<img src="http://openwetware.org/images/b/ba/Photo_%282%29.jpg" width="300px" height="250px" align="left">
</td>
<td>
<img src="http://openwetware.org/images/3/30/Photo_%284%29.jpg" width="300px" height="250px" align="right">
</td>
</tr>
</tbody>
</table>
</div>
<div class="caption">Fig.1 Cell Lab Quanta SC Flow Cytometer</div><br>
<h5 id=8>2-1-5 Confirming sequence specificity of DNA</h5>
<h5 id=8>2-1-5 Confirming sequence specificity of DNA</h5>
<h5>Making liposome</h5>
<h5>Making liposome</h5>
Line 481: Line 506:
</tr>
</tr>
</table>
</table>
Table12 The sequence of the strands<br>
<div class="captiontable">
Table12 The sequence of the strands</div><br>
<br>
<br>
<h5>Confirming sequence specificity of DNA</h5>
<h5>Confirming sequence specificity of DNA</h5>
Line 489: Line 515:
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> Liposome (with GFP inside) (4mM)</td>
<td> Liposome (with GFP inside) (4mM)</td>
<td> 10µl
<td> 10µL
</td>
</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> Origami-anchor DNA(A) (10uM)</td>
<td> Origami-anchor DNA(A) (10uM)</td>
<td> 25µl</td>
<td> 25µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> 1xTAE Mg2+ </td>
<td> 1xTAE Mg<sup>2+</sup></td>
<td> 55µl</td>
<td> 55µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> Key DNA(A) (5nM)</td>
<td> Key DNA(A) (5nM)</td>
<td> 20µl</td>
<td> 20µL</td>
</tr>
</tr>
</table>
</table><div class="captiontable">
Table13 Sample1<br><br>
Table13 Sample1</div><br><br>


Sample2 has Origami-anchor DNA(A) and Key DNA(B).<br>
Sample2 has Origami-anchor DNA(A) and Key DNA(B).<br>
Line 511: Line 537:
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> Liposome (with GFP inside) (4mM)</td>
<td> Liposome (with GFP inside) (4mM)</td>
<td> 10µl
<td> 10µL
</td>
</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> Origami-anchor DNA(B) (10uM)</td>
<td> Origami-anchor DNA(B) (10uM)</td>
<td> 25µl</td>
<td> 25µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> 1xTAE Mg2+ </td>
<td> 1xTAE Mg<sup>2+</sup></td>
<td> 55µl</td>
<td> 55µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> Key DNA(B) (5nM)</td>
<td> Key DNA(B) (5nM)</td>
<td> 20µl</td>
<td> 20µL</td>
</tr>
</tr>
</table>
</table>
Table14 Sample2<br><br>
<div class="captiontable">
Table14 Sample2</div><br><br>


The processes to mix liposomes, Origami-anchor DNA and Key DNA are the same as 2-1-4.<br>
The processes to mix liposomes, Origami-anchor DNA and Key DNA are the same as 2-1-4.<br>
Line 548: Line 575:
<td>Outer Buffer </td>
<td>Outer Buffer </td>
<td>STE(as substitute for GFP)</td>
<td>STE(as substitute for GFP)</td>
<td>10µl</td>
<td>10µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td></td>
<td></td>
<td>glucose(1M)</td>
<td>glucose(1M)</td>
<td>250µl </td>
<td>250µL </td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td></td>
<td></td>
<td>25×TAE</td>
<td>25×TAE</td>
<td>20µl </td>
<td>20µL </td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td></td>
<td></td>
<td>25×TAE</td>
<td>25×TAE</td>
<td>20µl </td>
<td>20µL </td>
</tr>
</tr>


Line 569: Line 596:
<td>LiposomeA Inner Buffer</td>
<td>LiposomeA Inner Buffer</td>
<td>GFP</td>
<td>GFP</td>
<td>5µl</td>
<td>5µL</td>
</tr>
</tr>
<tr bgcolor="SpringGreen">
<tr bgcolor="SpringGreen">
<td> </td>
<td> </td>
<td>sucrose(1M)</td>
<td>sucrose(1M)</td>
<td>125µl</td>
<td>125µL</td>
</tr>
</tr>
<tr bgcolor="SpringGreen">
<tr bgcolor="SpringGreen">
<td> </td>
<td> </td>
<td>25×TAE Mg<sup>2+</sup></td>
<td>25×TAE Mg<sup>2+</sup></td>
<td>10µl</td>
<td>10µL</td>
</tr>
</tr>
<tr bgcolor="SpringGreen">
<tr bgcolor="SpringGreen">
<td> </td>
<td> </td>
<td>mQ</td>
<td>mQ</td>
<td>110µl</td>
<td>110µL</td>
</tr>
</tr>


Line 590: Line 617:
<td>LiposomeB Inner Buffer</td>
<td>LiposomeB Inner Buffer</td>
<td>Rhodamine</td>
<td>Rhodamine</td>
<td>0.5µl</td>
<td>0.5µL</td>
</tr>
</tr>
<tr bgcolor="#FF6699">
<tr bgcolor="#FF6699">
<td> </td>
<td> </td>
<td>sucrose(1M)</td>
<td>sucrose(1M)</td>
<td>12.5µl</td>
<td>12.5µL</td>
</tr>
</tr>
<tr bgcolor=" #FF6699">
<tr bgcolor=" #FF6699">
<td> </td>
<td> </td>
<td>25×TAE Mg<sup>2+</sup></td>
<td>25×TAE Mg<sup>2+</sup></td>
<td>10µl</td>
<td>10µL</td>
</tr>
</tr>
<tr bgcolor=" #FF6699">
<tr bgcolor=" #FF6699">
<td> </td>
<td> </td>
<td>mQ</td>
<td>mQ</td>
<td>110µl</td>
<td>110µL</td>
</tr>
</tr>
</table>
</table>
Line 624: Line 651:
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>STE</td>
<td>STE</td>
<td> 10µl
<td> 10µL
</td>
</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> glucose (1M)</td>
<td> glucose (1M)</td>
<td> 250µl</td>
<td> 250µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>HEPES (1M)</td>
<td>HEPES (1M)</td>
<td> 5µl</td>
<td> 5µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> MgCl2 (1M)</td>
<td> MgCl<sub>2</sub> (1M)</td>
<td> 6.25µl</td>
<td> 6.3µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>mQ</td>
<td>mQ</td>
<td> 228.8µl</td>
<td> 228.8µL</td>
</tr>
</tr>
</table>
</table>
Table15 500µl outer buffer <br><br>
<div class="captiontable">Table15 500µL outer buffer</div><br><br>


<table border cellspacing="3" bgcolor="lightyellow">
<table border cellspacing="3" bgcolor="lightyellow">
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>GFP</td>
<td>GFP</td>
<td> 10µl
<td> 10µL
</td>
</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> glucose (1M)</td>
<td> glucose (1M)</td>
<td> 250µl</td>
<td> 250µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>HEPES (1M)</td>
<td>HEPES (1M)</td>
<td> 5µl</td>
<td> 5µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> MgCl2 (1M)</td>
<td> MgCl<sub>2</sub> (1M)</td>
<td> 6.25µl</td>
<td> 6.3µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>mQ</td>
<td>mQ</td>
<td> 228.8µl</td>
<td> 228.8µL</td>
</tr>
</tr>
</table>
</table><div class="captiontable">Table16 Inner buffer (green) </div><br><br>
Table16 Inner buffer (green) <br><br>


<table border cellspacing="3" bgcolor="lightyellow">
<table border cellspacing="3" bgcolor="lightyellow">
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> Texas-Red dextran</td>
<td> Texas-Red dextran</td>
<td> 20µl
<td> 20µL
</td>
</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> glucose (1M)</td>
<td> glucose (1M)</td>
<td> 250µl</td>
<td> 250µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>HEPES (1M)</td>
<td>HEPES (1M)</td>
<td> 5µl</td>
<td> 5µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> MgCl2 (1M)</td>
<td> MgCl<sub>2</sub> (1M)</td>
<td> 6.25µl</td>
<td> 6.3µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>mQ</td>
<td>mQ</td>
<td> 218.8µl</td>
<td> 218.8µL</td>
</tr>
</tr>
</table>
</table>
Table17 Inner buffer (red)<br><br>
<div class="captiontable">Table17 Inner buffer (red) </div><br><br>


<table border cellspacing="3" bgcolor="lightyellow">
<table border cellspacing="3" bgcolor="lightyellow">
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>DOPC (10mM)</td>
<td>DOPC (10mM)</td>
<td> 20µl
<td> 20µL
</td>
</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> DPPC (10mM)</td>
<td> DPPC (10mM)</td>
<td> 20µl</td>
<td> 20µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>cholesterol (10mM)</td>
<td>cholesterol (10mM)</td>
<td> 20µl</td>
<td> 20µL</td>
</tr>
</tr>
</table>
</table>
Table18 Phase-separated liposome<br><br>
<div class="captiontable">Table18 Phase-separated liposome</div><br><br>
1. Tapping of inner buffer 2µl and lipid paraffin 50µl<br>
1. Put inner buffer (2 μL) in mineral oil (50 μL), and tapping to form emulsion<br>
2. Putting L paraffin 50µl on outer buffer 50µl<br>
2. Putting mineral oil (50 μL) on outer buffer (50 μL)<br>
3. Putting 1(inner buffer + lipid paraffin) on 2 (L paraffin +outer buffer) <br>  
3. Putting 1(emulsion) on 2 (mineral oil on outer buffer) <br>
4. Centrifuging 3 sample for 5minutes<br>
4. Centrifuging 3 (sample) for 5minutes to form liposomes<br>
5. Observing leak of liposomes from the bottom of tubes by needles<br>
5. Collecting liposomes from the bottom of tubes by needles<br><br>


<h5 id="12">2-2-2 Confirming sequence specificity of DNA</h5>
<h5 id="12">2-2-2 Confirming sequence specificity of DNA</h5>


The protocol of outer buffer and inner buffer(green) was the same as that in 2-2-1.
The components of inner buffer for the Green liposomes and outer buffer were the same as that in 2-2-1. The inner buffer for the Red liposomes, below is the recipe.<br>
As for the inner buffer (red), below is the recipe.<br>


<table border cellspacing="3" bgcolor="lightyellow">
<table border cellspacing="3" bgcolor="lightyellow">
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> Texas-Red dextran</td>
<td> Texas-Red dextran</td>
<td> 100µl
<td> 100µL
</td>
</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> glucose (1M)</td>
<td> glucose (1M)</td>
<td> 250µl</td>
<td> 250µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>HEPES (1M)</td>
<td>HEPES (1M)</td>
<td> 5µl</td>
<td> 5µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td> MgCl2 (1M)</td>
<td> MgCl<sub>2</sub> (1M)</td>
<td> 6.25µl</td>
<td> 6.3µL</td>
</tr>
</tr>
<tr bgcolor="moccasin">
<tr bgcolor="moccasin">
<td>mQ</td>
<td>mQ</td>
<td> 138.8µl</td>
<td> 138.8µL</td>
</tr>
</tr>
</table>
</table><div class="captiontable">
Table19 Inner buffer (red)<br><br>
Table19 Inner buffer (red)</div><br><br>
We named liposomes with GFP inside “liposome A”, and liposomes with Texas-Red dextran “liposome B”.<br>
We named liposomes with GFP inside “Green liposome”, and liposomes with Texas-Red dextran “Red liposome”.
Each liposome has different Flower-anchor DNA. <br>
Each liposome has the corresponding Flower-anchor DNA of different sequences. <br>
1. Making liposomes by the same method as 2-2-1<br>
1. Liposome formation metohds is the same as 2-2-1<br>
2. Adding liposome A 3µl into 5µl Flower-anchor DNA for liposome A(50µM); adding liposome B 3µl into Flower-anchor DNA for liposome B(50µM)<br>
2. Adding 50 µM A-flower-anchor DNA (5 μL) into Green liposome (3 µL) or Red liposome (3 µL)<br>
<br>
<br>
<table border cellspacing="3" bgcolor="lightyellow">
<table border cellspacing="3" bgcolor="lightyellow">
Line 777: Line 802:
</table>
</table>


Table20 The sequence of Flower-anchor DNA<br>
<div class="captiontable">Table20 The sequence of Flower-anchor DNA</div><br>
<br>
In the case of control experiment, buffer solution (10mM HEPES Mg+2, 4µL) for the key DNA was added instead of Key DNA.<br>
<br>
<br>
3. Taking 4µl of each liposome and mixing them<br>
4. Adding Key DNA (100µM) for liposome B 4µl into 3<br>
Preparing control sample : instead of Key DNA, adding buffer solution (10mM HEPES Mg+2, 4µl)<br>
<h6>Images</h6>
<h6>Images</h6>
Without Key DNA(Only buffer)<br>
Without Key DNA (Only buffer)<br>
 
<font size=-1>A(Green):B(Red)=16:17 (n=23)</font>
<table>
<table>
<tr>
<tr>
  <td>
  <td>
<img src="http://openwetware.org/images/d/dd/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%891.jpg" width="400" height="300">
<img src="http://openwetware.org/images/c/cb/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%91.jpg" width="400" height="300">
  </td>
  </td>
  <td>
  <td>
<img src="http://openwetware.org/images/9/92/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%892.jpg" width="400" height="300">
<img src="http://openwetware.org/images/9/96/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%92.jpg" width="400" height="300">
  </td>
  </td>
</tr>
</tr>
<tr>
<tr>
  <td>
  <td>
<img src="http://openwetware.org/images/5/54/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%893.jpg" width="400" height="300">
<img src="http://openwetware.org/images/e/ee/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%93.jpg" width="400" height="300">
  </td>
  </td>
<td>
<td>
<img src="http://openwetware.org/images/3/3b/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%894.jpg" width="400" height="300">
<img src="http://openwetware.org/images/f/ff/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%94.jpg" width="400" height="300">
  </td>
  </td>
</tr>
</tr>
<tr>
<tr>
  <td>
  <td>
<img src="http://openwetware.org/images/a/aa/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%895.jpg" width="400" height="300">
<img src="http://openwetware.org/images/7/76/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%95.jpg" width="400" height="300">
  </td>
  </td>
  <td>
  <td>
<img src="http://openwetware.org/images/f/f1/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%896.jpg" width="400" height="300">
<img src="http://openwetware.org/images/7/76/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%95.jpg" width="400" height="300">
  </td>
  </td>
</tr>
</tr>
<tr>
<tr>
  <td>
  <td>
<img src="http://openwetware.org/images/d/d4/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%897.jpg" width="400" height="300">
<img src="http://openwetware.org/images/c/c0/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%97.jpg" width="400" height="300">
  </td>
  </td>
  <td>
  <td>
<img src="http://openwetware.org/images/5/54/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%898.jpg" width="400" height="300">
<img src="http://openwetware.org/images/0/06/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%98.jpg" width="400" height="300">
  </td>
  </td>
</tr>
</tr>
<tr>
<tr>
  <td>
  <td>
<img src="http://openwetware.org/images/3/3f/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%899.jpg" width="400" height="300">
<img src="http://openwetware.org/images/4/4f/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%99.jpg" width="400" height="300">
  </td>
  </td>
  <td>
  <td>
Line 829: Line 852:




<br>


With Key DNA<br>
With Key DNA<br>
<font size=-1>A(Green):B(Red)=17:2 (n=19)</font>
<table>
<table>
<tr>
<tr>
  <td>
  <td>
<img src="">
<img src="http://openwetware.org/images/d/dd/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%891.jpg" width="400" height="300">
  </td>
  </td>
  <td>
  <td>
<img src=" ">
<img src="http://openwetware.org/images/9/92/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%892.jpg" width="400" height="300">
  </td>
  </td>
</tr>
</tr>
<tr>
<tr>
  <td>
  <td>
<img src=" ">
<img src="http://openwetware.org/images/5/54/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%893.jpg" width="400" height="300">
  </td>
  </td>
<img src="">
<td>
<td>
<img src="http://openwetware.org/images/3/3b/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%894.jpg" width="400" height="300">
  </td>
  </td>
</tr>
</tr>
<tr>
<tr>
  <td>
  <td>
<img src="">
<img src="http://openwetware.org/images/a/aa/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%895.jpg" width="400" height="300">
  </td>
  </td>
  <td>
  <td>
<img src="">
<img src="http://openwetware.org/images/f/f1/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%896.jpg" width="400" height="300">
  </td>
  </td>
</tr>
</tr>
<tr>
<tr>
  <td>
  <td>
<img src="">
<img src="http://openwetware.org/images/d/d4/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%897.jpg" width="400" height="300">
  </td>
  </td>
  <td>
  <td>
<img src="">
<img src="http://openwetware.org/images/5/54/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%898.jpg" width="400" height="300">
  </td>
  </td>
</tr>
</tr>
<tr>
<tr>
  <td>
  <td>
<img src="">
<img src="http://openwetware.org/images/3/3f/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%899.jpg" width="400" height="300">
  </td>
  </td>
  <td>
  <td>
Line 872: Line 897:
</tr>
</tr>
</table>
</table>
         </article>
         </article>



Latest revision as of 06:55, 27 October 2013

<html> <head> <style>


/********************** Hide MediaWiki and init CSS, overwrite by bootstrap.css バルス**********************/

body{

background:none;

} html, body, div, span, applet, object, iframe, h1, h2, h3, h4, h5, h6, p, blockquote, pre, a, abbr, acronym, address, big, cite, code, del, dfn, em, img, ins, kbd, q, s, samp, small, strike, strong, sub, sup, tt, var, b, u, i, center, dl, dt, dd, ol, ul, li, fieldset, form, label, legend, table, caption, tbody, tfoot, thead, tr, th, td, article, aside, canvas, details, embed, figure, figcaption, footer, header, hgroup, menu, nav, output, ruby, section, summary, time, mark, audio, video{

margin:0;
padding:0;
/* font-size:100%; */
 border:0;
outline:0;

} a, a:link, a:visited, a:hover, a:active{

text-decoration:none

}

/*訪れたリンクを白くするよ*/ .whiteSendai:visited{

color:#FFFFFF!important;

}

/*左詰め、真ん中、右詰め*/ .leftSendai { text-align: left; } .centerSendai { text-align: center; } .rightSendai { text-align: right; }


.firstHeading {

display:none;

}

  1. content{
border-style:none;
margin:0;
padding:0;

}

  1. globalWrapper{
font-size:100%;

}

  1. contentSub{
display:none;

}

  1. column-one{
display:none;

}

  1. footer{
display:none;

}

  1. globalWrapper{
font-size:100%;

}

  1. bodyContent h1, #bodyContent h2{
 margin-top: 20px;
 margin-bottom: 10px;

}


  1. bodyContent h3{
 margin-top: 20px;
 margin-bottom: 10px;
 border-bottom-width: medium;
 border-bottom-style: solid;
 border-bottom-color: gray;

}

  1. bodyContent h4{
 margin-top: 20px;
 margin-bottom: 10px;
 border-bottom-width: thin;
 border-bottom-style: solid;
 border-bottom-color: gray;

}

  1. bodyContent h5, #bodyContent h6{
 margin-top: 10px;
 margin-bottom: 10px;

/**** border-bottom-width: thin;

 border-bottom-style: solid;
 border-bottom-color: gray;
        • /

}

/********************************* Hide MediaWiki end *********************************/


/* Structure */ html{ background: #eee; } body {

 padding: 0px;
 background: #fff;
 color: #333;
 margin: 0 auto;
 max-width: 900px;
 font: 1em/1.5 "Helvetica Neue", Helvetica, Arial, sans-serif;
 }

a {

 color: #105672;

}

header {/****position: fixed; ****/

       /******width: 100%;****/
       height: 90px;
       z-index: 1;

background: #F17F25;

        padding:0.01em 0.5em 1.5em ;

color: #fff; line-height: 1;

}

header h1{ margin-bottom: 0; }

header h1 span{ display: inline; color: rgba(255,255,255,.4); }

header span{ display: block; color: rgba(255,255,255,.2); font-weight: 300; margin-bottom: 1.6em }

header nav{ float: right; text-align: right } header nav div{ font-size: .8em; } header nav div a { font-weight: 300; padding: .3em .5em } header nav a{ color: #fff; display: inline-block; padding: .3em .8em }

header nav a:hover, header nav a:focus{ color: rgba(255,255,255,.6) }


[role=main]{ padding:1.5em 3em; } article{ padding: 1em 0; text-align: justify; text-justify: inter-ideograph;

}


footer{ background: #333; color: #fff; padding: 1em 3em;

       clear: both;    /***2段組みの左右のfloatを解除***/

}

/* Typography */

p{ font: 1em/1.5 Palatino, "Palatino Linotype", Georgia, Times, "Times New Roman", serif; }

p.sukima{

       font-size: 150%;
       font-weight: normal;
       font-family: Helvetica;
       background: #bbb;
       padding-left: 1.2em;

}

img{ max-width: 100%; /***** height: auto; *****/ }


blockquote{ float: left; margin: 1em 3em; } blockquote p{ font-size: 1.4em; line-height: 1.2; font-weight: 700; font-style:italic; } a{ font: 700 1em/1.5 "Helvetica Neue", Helvetica, Arial, sans-serif; text-decoration: none } a:hover, a:focus{ color: #000; } a:active{ position: relative; top:1px; }

ol{margin: 1em 0 1em 0; padding-left: 2em; } li{ margin: 0; }

/* Tabs */

  1. tabs

{ /*****position:fixed;****/

      width: 900px; 

}

.js-on #tabs article { display:none }

  1. tabs, #tabs nav a.active{

background: #FFF; color: #111; }

  1. tabs nav

{ position: relative; overflow: hidden; display: table; background: #bbb; }


  1. tabs nav a

{ width:900px; display:table-cell; padding:1em; text-align:center; color: #333; }

  1. tabs nav a:hover,#tabs nav a:focus

{ background:#eee }

  1. tabs article

{ padding:2em; }


.js-on #tabs article.active { display:block; }

  1. tabs #mobiles{

display:none; border-radius: 0; }

  1. tabs #mobiles a, #tabs #mobiles a:first-child, #tabs #mobiles a:last-child{

width:300px; border-radius: 0; }


/* Media queries */ @media screen and (min-width:900px) { body{font-size: 1.1em;} }

@media screen and (max-width:600px) { #tabs nav{ display: none; position: relative; } #tabs #mobiles{ display:block; } #tabs article { display:block; } } @media screen and (max-width:480px) { blockquote{ float: none; }

header nav a{ padding:.7em .8em } header nav{ float: none; margin: -.5em -3em 0; background: #000; overflow: hidden; text-align: left } header nav a{ border-right: 1px solid #222 } [role=main]{ padding:1.5em 2em; } header nav div{ display: none; }

}

/*column content*/

  1. content-right {

width:48%; /***段落の横幅***/ float:right; /***右に寄せる(他の要素を左に回り込ませる)***/ margin: 10px; }

  1. content-left {

width:47%; /***サイドの横幅***/ float:left; /***左に寄せる***/ margin: 10px; }

/*****キャプションレフト*****/

div.caption-left{ float: left; padding: 0 5px 5px 5px; }

.caption-left span{ display: block; text-align: center;

       font-size: smaller;
       font-weight: bold;

}

div.clear{ clear: both; margin: 0 0 10px 0; }

/*****キャプションライト*****/

div.caption-right{ float: right; padding: 0 5px 5px 5px; }

.caption-right span{ display: block; text-align: center;

       font-size: smaller;
       font-weight: bold;

}

div.clear{ clear: both; margin: 0 0 10px 0; }

/***floatの影響を絶つ。

のように使う***/

.c-both { clear: both; }

div.title{

        font-style: normal;
        font-weight: bold;
        font-size: 70px;
        line-height: 70px;
        font-family: Helvetica;

}

div.caption{

       text-align: center;
       font-size: smaller;
       font-weight: bold;

}

div.captiontable{

       font-size: smaller;
       font-weight: bold;

}

/*topに戻る*/

  1. ttop {position:fixed;
      bottom:140px;
      left:auto;margin:0 0 0 905px; /* マージン:上 右 下 左 */
      width:100px;
      height:390px;
      background:url(http://openwetware.org/images/f/f2/%E5%90%8D%E7%A7%B0%E6%9C%AA%E8%A8%AD%E5%AE%9A-1.png) no-repeat left bottom;}

/* IE6以下用、アスタリスクハックでググれ */

  • html #ttop {margin:0 0 -390px 0;
             position:relative;bottom:490px; /* 上で設定した ttopの高さ390px+下100px */
             left:960px;}
  1. ttop:hover {background:url(http://openwetware.org/images/b/b9/Top2.png) no-repeat left bottom;/* 画像の高さによって適当に調整 */
            }

a.page_top {display:block;width:100px;height:390px;}


</style> </head> </html> <html xmlns="http://www.w3.org/1999/xhtml"> <head>

   <title>Biomod2013 Sendai ver2.0</title>
   <meta name="viewport" content="width=device-width,initial-scale=1">
   
   <style type="text/css">
   h1{color: white;}
   </style>

</head>

<body>

   <header>
        <nav>      



          <a href="http://openwetware.org/wiki/Biomod/2013/Sendai" class="whiteSendai">Top</a> 
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/project" class="whiteSendai">Project</a>
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/design" class="whiteSendai">Design</a> 
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/calcuation" class="whiteSendai">Calculation</a>
           <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/experiment" class="whiteSendai">Experiment</a>

<a href="http://openwetware.org/wiki/Biomod/2013" class="whiteSendai" style="float:right;"><img src="http://openwetware.org/images/6/6e/Biomod-logo.jpg"

                                              width="75" height="75" alt="Biomod2013" border="0"></a>
<a href="http://openwetware.org/wiki/Biomod/2013/Sendai/protocol" class="whiteSendai">Protocol</a> <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/future" class="whiteSendai">Future</a> <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/member" class="whiteSendai">Member</a> <a href="http://openwetware.org/wiki/Biomod/2013/Sendai/sponsor" class="whiteSendai">Sponsor</a> </nav>

<a href="http://openwetware.org/wiki/Biomod/2013/Sendai">

Biomod2013
  Team
Sendai

</a>

   </header>
<a href="#top" class="page_top" onfocus="this.blur();" onclick="scrollTo(0,0); return false;" title="Top"></a>

       <article>

Protocol

Contents

  • <a href="#chain"> 1 First stage: Sensing system</a>
    • <a href="#bending"> 1-1 Disruption of temperature sensitive liposomes</a>
  • <a href="#Flower"> 2 Second stage: Amplification system</a>
    • <a href="#sensing"> 2-1 DNA Origami approach</a>
      • <a href="#5"> 2-1-1 Making DNA Origami</a>
      • <a href="#6"> 2-1-2 Labeling DNA Origami with fluorescent-tagged DNA</a>
      • <a href="#7"> 2-1-3 Disruption of liposomes by DNA Origami (microscopic analysis)</a>
      • <a href="#13"> 2-1-4 Disruption of liposomes by DNA Origami (quantitative analysis)</a>
      • <a href="#8"> 2-1-5 Confirming sequence specificity of DNA</a>
    • <a href="#9"> 2-2 Flower DNA approach</a>
      • <a href="#11"> 2-2-1 Disruption of liposomes by Flower DNA</a>
      • <a href="#12"> 2-2-2 Confirming sequence specificity of DNA</a>

First stage: Sensing system

1-1 Disruption of temperature sensitive liposomes

Structure of NIPAM

<img src="http://openwetware.org/images/f/f5/Nipam.png"width="180"height="210">
poly-N-isopropyl acrylamide

Making liposome
Egg York PC(10mM) 10µL
Cholesterol(10mM) 1µL
CHCl3 90µL

Table1 Materials for liposome preparation

1. Egg york PC and cholesterol solution was mixed and put on a glass tube.
2. To create a dried lipid film, the lipid solution was put on a glass tube then The solution was dried by argon gas and then in vacuum for a night.
3. Adding the pure water onto the dried lipid film to obtaining the giant liposomes.
4. The liposome solution 10µL was gently mixed with 25μl NIPAM solution (2mg/ml in the pure water).


Second stage: Amplification system

2-1 DNA Origami approach

2-1-1 Making DNA Origami
Making DNA origami
DNA origami recipe

We designed DNA origami by <A Href="http://cadnano.org/">caDNAno2</A>, software for designing 2D and 3D DNA origami.
Our DNA origami has 141 staples that have 30nt free single-stranded parts outside the DNA origami. The sequence of the parts is “each DNA origami staple-TTTTTTTTTTTTTTTCTGTCGCATCGAGAG”.
Between the staple and unique (CTGTCGCATCGAGAG) sequences, 15 T bases are inserted. They are to make a T loop. Thanks to this T loop, single-stranded DNA complementary to the unique sequences (such as Origami-anchor DNA) are expected to easily hybridize with the unique sequence.
The 30nt single-stranded parts are stable till 37°C, according to <A Href="http://www.nupack.org/">NUPACK</A>).
The 141 staples have the same length so that they may be present at the same intervals in the DNA origami.
Each side of our origami is not fully covered with staples, and single-stranded M13 remains. This is for preventing π-π interaction and stacking by hydrophobic interaction between base pairs of double-stranded DNA.
This design enables each DNA origami to exist individually.

The list of strands

The other strands exept DNA origami staples used in our experiment are shown in Table2.
The sequence of Origami-anchor DNA is shown below (at the first sequence in Table2). For labeling, we also attached fluorescent-tagged DNA (at the second in Table2) to our DNA origami.
To hybridize both Origami-anchor DNA and fluorescent-tagged DNA with the same unique single-stranded parts of our Origami, we arranged two kinds of adaptor DNA (at the third and fourth in Table2). One adaptor has complementary sequences to both the unique sequence and Origami-anchor DNA. The other has complementary sequences to both the unique sequence and the fluorescent-tagged DNA. Thanks to these two adaptors, two different strands can bind to the same unique sequence.

The kinds of DNAtrands Its sequence
Origami-anchor DNA CCAGAAGACG
Fluorescent-tagged DNA ACTAGTGAGTGCAGCAGTCGTACCA
Adaptor strand for Origami-anchor DNA and the unique sequence in DNA origami CGTCTTCTGGCTCTCGATGCGACAG
Adaptor strand for fluorescent-tagged DNA and the unique sequence in DNA origami TGGTACGACTGCTGCACTCACTAGTCTCTCGATGCGACAG
Table2 The sequence of the strands


Annealing of DNA origami

The annealing solution is shown in Table3. The annealing was conducted for 2 hours and 51minutes (from 95 to 25°C: lower 1°C per 2 minutes).

<ur>
  • Annealing solution with fluorescent-tagged DNA 50µL
    84nM M13mp18 2.4µL
    Staples
    1µM migihaji 1µL
    1µM hidarihaji 1µL
    1µM ashibatemae 1µL
    200nM ashiba 5µL
    1µM cholesterol-hybridizing ssDNA 3µL
    1µM fluorescent-tagged DNA-hybridizing ssDNA 3µL
    5xTAE Mg2+ 10µL
    mQ 20.6µL
    1µM fluorescent-tagged DNA 3µM
  • Table3 Annealing solution with fluorescent-tagged DNA


  • Annealing solution with no fluorescent-tagged DNA (control) 50µL
    We changed 3µL fluorescent-tagged DNA in the above solution into the same quantity of mQ.


  • 2-1-2 Labeling DNA Origami with fluorescent-tagged DNA
    Electrophoresis

    We confirmed that our DNA origami was fluorescently labeled by electrophoresis.

    50µL of Annealing solution with fluorescent-tagged DNA (used in 2-1-1 Making DNA origami) contains 3µL of 1µM fluorescent-tagged DNA.
    To see if the origami binds to the fluorescent-tagged DNA in shorter time, we added 0.6µL of 1µM fluorescent-tagged DNA into 10 µL control annealing solution, and left it for 40 minutes.

    Agarose gel recipe: 0.4g agarose, 0.8ml 50xTAE, 39.2ml mQ

    The electrophoresis was conducted with 1% agarose gel, CV 100V, for 50 minutes.

    2-1-3 Disruption of liposomes by DNA Origami (microscopic analysis)
    Making liposome

    1. Drying the liposomes below with argon gas and letting them stand for a night
    2. Adding 1xTAE Mg2+ 100µL to 1 and heating it in warm water (about 90 deg C) for a few hours

    DOPC (10mM) 1µL
    CHCl3 99µL
    Table4 Materials for Making liposomes


    Concentration of Origami-anchor DNA

    To float Origami-anchor DNA on the surface of liposome, we added Origami-anchor DNA into liposomes at the final concentration of 0.018, 0.069, 1.8, and 6.9µM. Each sample was as follows.

    <ur>
  • Liposome with 0.018µM Origami-anchor DNA: 1µL 0.1µM Origami-anchor DNA and 2.5µL liposome
  • Liposome with 0.069µM Origami-anchor DNA: 10µL 0.1µM DNAs and 2.5µL liposome
  • Liposome with 1.8µM Origami-anchor DNA: 1µL 10µM DNAs and 2.5µL liposome
  • Liposome with 6.9µM Origami-anchor DNA: 10µL 10µM DNAs and 2.5µL liposome

  • Observation by phase and fluorescent microscope

    We observed each sample with a phase microscope.

    Then we added 2µL DNA origami into each sample and saw if some change would happen with a fluorescent microscope.
    The DNA origami for fluorescent microscope observation was made according to Table5 annealing solution. It contained more cholesterol-hybridizing ssDNAs and fluorescent-tagged DNA-hybridizing ssDNAs than Annealing solution used in 2-1-1, because we considered a sample with more fluorescent molecules was suitable for observation.

    84nM M13mp18 2.4µL
    Staples
    1µM migihaji 1µL
    1µM hidarihaji 1µL
    1µM ashibatemae 1µL
    200nM ashiba 5µL
    100µM cholesterol-hybridizing ssDNA 4.2µL
    100µM fluorescent-tagged DNA-hybridizing ssDNA 4.2µL
    5xTAE Mg2+ 10µL
    mQ 23.5µL
    Table5 50µL Annealing solution for fluorescent microscope observation


    After annealing, we added 4.2µL 100µM fluorescent-tagged DNA (the same quantity of fluorescent-tagged DNA-hybridizing ssDNA).

    2-1-4 Disruption of liposomes by DNA Origami (quantitative analysis)
    Making liposome
    <Img Src="http://openwetware.org/images/6/6d/Wo_method-%E5%AE%8C%E6%88%90%E7%89%88.png" style="padding-left:10mm">Fig.4 the droplet-transfer method
    

    We make phase-separatied liposomes made of DOPC, DPPC, DOPE and cholesterol.
    Phase-separated liposomes are liposomes consisting of several kinds of lipids. It has less fluidity and its membranee is more stiff than normal liposomes.
    Due to the above reasons, we consider that phase-separated liposomes are more suitable to be disrupted. Thus, this time, we used phase-separated liposomes.
    Liposomes were formed by the droplet-transfer method Pautot et al., PNAS, 100, 10718-21 (2003).

    DOPC(10mM) 20µL
    DPPC(10mM) 20µL
    Cholesterol(10mM) 20µL
    DOPE(10mM) 20µL
    chloroform 260µL
    Table6 Materials for Making liposomes


    1 Drying the liposomes above with argon gas and letting them stand for a night
    2 Adding mineral oil 260µL to 1 and sonicating them (43Hz, 60 deg C, for 2 hours)
    3 Preparing 1.5ml microtube and pouring outer buffer 50µL. Then picking up 50µL from 2 and adding it on the outer buffer (softly, to make a bilayer)

    glucose(1M) 125µL
    25xTAE Mg2+ 10µL
    mQ 110µL
    Table7 Outer Buffer (250µL)



    4 Preparing 0.2 ml microtube and pouring inner buffer 2µL. Then picking up 50µL from 2, adding it on the inner buffer, and mixing them by tapping

    GFP(0.5 mM) 5µL
    sucrose(1M) 125µL
    25xTAE Mg2+ 10µL
    mQ 110µL
    Table8 Inner Buffer (250µL)


    5 Pouring all the solution (52µL) of 4 into the 1.5ml tube (softly, to make a three-layer) 6 Centrifuging it for 30 seconds and taking only the bottom layer

    Disruption of liposomes by DNA Origami

    Sample1 is the negative control. It is the mixture of liposome and Origami-anchor DNA.

    Liposome (with GFP inside) (4mM) 10µL
    Origami-anchor DNA (10uM) 25µL
    1xTAE Mg2+ 75µL
    Table9 Sample1: negative control


    Sample2 is the positive control. It is the mixture of liposome, Origami-anchor DNA, and surfactant (NP40).

    Liposome (with GFP inside) (4mM) 10µL
    Origami-anchor DNA (10uM) 25µL
    1xTAE Mg2+ 75µL
    Surfactant (NP40) 2µL
    Table10 Sample2: positive control


    Sample3 is the mixture of liposome, Origami-anchor DNA, and Key DNA Origami.

    Liposome (with GFP inside) (4mM) 10µL
    Origami-anchor DNA (10uM) 25µL
    1xTAE Mg2+ 55µL
    Key DNA (5nM) 20µL
    Table11 Sample3


    1. Adding Origami-anchor DNA to each sample, and leaving it for 30 minutes.
    2. Adding Key DNA to each sample, and leaving it for 10 minutes.
    3. Taking each sample 50µL and measuring each sample’s fluorescence intensity of 7-13 µm diameter liposomes by Cell Lab Quanta SC Flow Cytometer.

    Image of Cell Lab Quanta SC Flow Cytometer

    <tbody> </tbody>

    <img src="http://openwetware.org/images/b/ba/Photo_%282%29.jpg" width="300px" height="250px" align="left">

    <img src="http://openwetware.org/images/3/30/Photo_%284%29.jpg" width="300px" height="250px" align="right">

    Fig.1 Cell Lab Quanta SC Flow Cytometer

    2-1-5 Confirming sequence specificity of DNA
    Making liposome

    We made liposomes in the same way as 2-1-4.

    The list of strands

    To confirm sequence specificity of DNA, we prepared two different pairs of Origami-anchor DNA and adaptor strand.
    We call Key DNA with adoptor strand(A) as Key DNA(A) and Key DNA with adoptor strand(B) as Key DNA(B) .

    The kinds of DNAtrands Its sequence
    Origami-anchor DNA(A) CCAGAAGACG
    Adaptor strand for Origami-anchor DNA(A) CGTCTTCTGGCTCTCGATGCGACAG
    Origami-anchor DNA(B) TCCACTAACG
    Adaptor strand for Origami-anchor DNA(B) CGTTAGTGGACTCTCGATGCGACAG
    Table12 The sequence of the strands


    Confirming sequence specificity of DNA

    Sample1 has complementary Origami-anchor DNA(A) and Key DNA(A).

    Liposome (with GFP inside) (4mM) 10µL
    Origami-anchor DNA(A) (10uM) 25µL
    1xTAE Mg2+ 55µL
    Key DNA(A) (5nM) 20µL
    Table13 Sample1


    Sample2 has Origami-anchor DNA(A) and Key DNA(B).

    Liposome (with GFP inside) (4mM) 10µL
    Origami-anchor DNA(B) (10uM) 25µL
    1xTAE Mg2+ 55µL
    Key DNA(B) (5nM) 20µL
    Table14 Sample2


    The processes to mix liposomes, Origami-anchor DNA and Key DNA are the same as 2-1-4.







    2-2 Flower DNA approach

    2-2-1 Disruption of liposomes by Flower DNA

    The protocol to prepare liposomes was the same as that in 2-1-4.

    STE 10µL
    glucose (1M) 250µL
    HEPES (1M) 5µL
    MgCl2 (1M) 6.3µL
    mQ 228.8µL
    Table15 500µL outer buffer


    GFP 10µL
    glucose (1M) 250µL
    HEPES (1M) 5µL
    MgCl2 (1M) 6.3µL
    mQ 228.8µL
    Table16 Inner buffer (green)


    Texas-Red dextran 20µL
    glucose (1M) 250µL
    HEPES (1M) 5µL
    MgCl2 (1M) 6.3µL
    mQ 218.8µL
    Table17 Inner buffer (red)


    DOPC (10mM) 20µL
    DPPC (10mM) 20µL
    cholesterol (10mM) 20µL
    Table18 Phase-separated liposome


    1. Put inner buffer (2 μL) in mineral oil (50 μL), and tapping to form emulsion
    2. Putting mineral oil (50 μL) on outer buffer (50 μL)
    3. Putting 1(emulsion) on 2 (mineral oil on outer buffer)
    4. Centrifuging 3 (sample) for 5minutes to form liposomes
    5. Collecting liposomes from the bottom of tubes by needles

    2-2-2 Confirming sequence specificity of DNA

    The components of inner buffer for the Green liposomes and outer buffer were the same as that in 2-2-1. The inner buffer for the Red liposomes, below is the recipe.

    Texas-Red dextran 100µL
    glucose (1M) 250µL
    HEPES (1M) 5µL
    MgCl2 (1M) 6.3µL
    mQ 138.8µL
    Table19 Inner buffer (red)


    We named liposomes with GFP inside “Green liposome”, and liposomes with Texas-Red dextran “Red liposome”. Each liposome has the corresponding Flower-anchor DNA of different sequences.
    1. Liposome formation metohds is the same as 2-2-1
    2. Adding 50 µM A-flower-anchor DNA (5 μL) into Green liposome (3 µL) or Red liposome (3 µL)

    The kinds
    of DNAtrands
    Its sequence
    10nt Flower-anchor DNA(A) CCAGAAGACG
    50nt Flower-anchor DNA(A) CGTCTTCTGGGCGAACCACGGTTCCCAGCGTGACCTTCATGCTTAAGTTT
    10nt Flower-anchor DNA(B) TCCACTAACG
    50nt Flower-anchor DNA(B) CGTTAGTGGAGTATCCGTCAACCGCACCTATGGCAGCAAGTGAGCCTGTA
    Table20 The sequence of Flower-anchor DNA


    In the case of control experiment, buffer solution (10mM HEPES Mg+2, 4µL) for the key DNA was added instead of Key DNA.

    Images

    Without Key DNA (Only buffer)
    A(Green):B(Red)=16:17 (n=23)

    <img src="http://openwetware.org/images/c/cb/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%91.jpg" width="400" height="300">

    <img src="http://openwetware.org/images/9/96/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%92.jpg" width="400" height="300">

    <img src="http://openwetware.org/images/e/ee/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%93.jpg" width="400" height="300">

    <img src="http://openwetware.org/images/f/ff/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%94.jpg" width="400" height="300">

    <img src="http://openwetware.org/images/7/76/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%95.jpg" width="400" height="300">

    <img src="http://openwetware.org/images/7/76/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%95.jpg" width="400" height="300">

    <img src="http://openwetware.org/images/c/c0/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%97.jpg" width="400" height="300">

    <img src="http://openwetware.org/images/0/06/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%98.jpg" width="400" height="300">

    <img src="http://openwetware.org/images/4/4f/Ss%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%89%EF%BC%99.jpg" width="400" height="300">



    With Key DNA
    A(Green):B(Red)=17:2 (n=19)

    <img src="http://openwetware.org/images/d/dd/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%891.jpg" width="400" height="300">

    <img src="http://openwetware.org/images/9/92/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%892.jpg" width="400" height="300">

    <img src="http://openwetware.org/images/5/54/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%893.jpg" width="400" height="300">

    <img src="http://openwetware.org/images/3/3b/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%894.jpg" width="400" height="300">

    <img src="http://openwetware.org/images/a/aa/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%895.jpg" width="400" height="300">

    <img src="http://openwetware.org/images/f/f1/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%896.jpg" width="400" height="300">

    <img src="http://openwetware.org/images/d/d4/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%897.jpg" width="400" height="300">

    <img src="http://openwetware.org/images/5/54/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%898.jpg" width="400" height="300">

    <img src="http://openwetware.org/images/3/3f/S%E3%82%B9%E3%83%A9%E3%82%A4%E3%83%899.jpg" width="400" height="300">

           </article>
    
       
       <footer>
    

    © Copyright Biomod 2013 Team Sendai <a href="http://www.molbot.mech.tohoku.ac.jp/index.html">                   <img src="http://openwetware.org/images/3/36/Murata-nomura-logo.png" width="180" height="50" alt="Molcular Robotics Lab" border="0" align="right">          </a>     

    E-MAIL: <a href="mailto:biomod.teamsendai.2012@gmail.com">biomod.teamsendai.2012@gmail.com </a>

           

    <a href="?action=edit" align="center">

    edit

    </a>

       </footer>
       
    

    </body> </html> <html> <head>

           <script type="text/javascript">
         function tabs(a,g,j){document.body.className="js-on";var g=a.getElementsByTagName(g),d=[],c;this.active;this.total=g.length;this.container=a;e=a.insertBefore(document.createElement("nav"),g[0]),change=function(f){if(typeof this.active!=="undefined"){d[this.active].className=g[this.active].className=""}d[f].className=g[f].className="active";this.active=f},clickEvent=function(h,f){h.onclick=function(){change(f);return false}};for(var b=0;b<g.length;b++){d[b]=e.appendChild(document.createElement("a"));d[b].href="#";c=[g[b].getAttribute("data-title"),g[b].getElementsByTagName(j)[0]];d[b].innerHTML=c[0]!==null?c[0]:c[1]?c[1]["innerText"||"textContent"]:b+1;new clickEvent(d[b],b)}change(0)}tabs.prototype.change=function(b){change(b-1)};tabs.prototype.next=function(b){active===this.total-1?change(0):change(active+1)};tabs.prototype.prev=function(b){active===0?change(this.total-1):change(active-1)};tabs.prototype.responsive=function(d,c){nav=document.createElement("nav");nav.id="mobiles";nav.innerHTML='<a href="#" onclick="'+d+'.prev(); return false">'+c.prev+'</a><a href="#" onclick="'+d+'.next(); return false">'+c.next+"</a>";this.container.insertBefore(nav,this.container.firstChild);return this};
           </script>
           <script type="text/javascript">
    

    var myTabs = new tabs(document.getElementById("tabs"), "article", "h2").responsive("myTabs", { prev: "Previous", next: "Next" }); </script> </head> </html>