BME103:T130 Group 3 l2: Difference between revisions
(5 intermediate revisions by 3 users not shown) | |||
Line 26: | Line 26: | ||
==Thermal Cycler Engineering== | ==Thermal Cycler Engineering== | ||
Our re-design is based upon the [http://openpcr.org Open PCR] system originally designed by Josh Perfetto and Tito Jankowski.<br> | Our re-design is based upon the [http://openpcr.org Open PCR] system that was originally designed by Josh Perfetto and Tito Jankowski.<br> | ||
Line 38: | Line 38: | ||
'''Instructions'''<br> | '''Instructions'''<br> | ||
There was only a change in the material | There was only a change in the material that is used to make the heat sink and heating pad, so the assembly instruction will remain the same as the original design. | ||
<!--- From Week 4 exercise ---> | <!--- From Week 4 exercise ---> | ||
Line 112: | Line 112: | ||
9.) Drag circle to the background of the image <br> | 9.) Drag circle to the background of the image <br> | ||
10.) Record results <br> | 10.) Record results <br> | ||
11.) Repeat if necessary | 11.) Repeat if necessary or needed | ||
<br><br> | <br><br> | ||
Line 129: | Line 129: | ||
rs137852571 <Br> | rs137852571 <Br> | ||
SNP located at:5,255,325 <br> | |||
SNP:5,255,325 <br> | |||
Missense GTG→ATG <br> | Missense GTG→ATG <br> | ||
V[Val]→M[Met] <Br> | V[Val]→M[Met] <Br> | ||
Line 153: | Line 151: | ||
AGGGGTGGTGGGGAATTACC | AGGGGTGGTGGGGAATTACC | ||
'''Illustration''' | '''Illustration'''<br> | ||
[[Image:Photogroup3.JPG|600x300px]] | |||
<!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | <!--- Include an illustration that shows how your system's primers allow specific amplification of the disease-related SNP ---> | ||
<b> Bayesian Equation </b> <br><br> | |||
[[Image:58a49e1877dd22125514b93a41037fb1.png|519×48px]] <br> | |||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> |
Latest revision as of 13:37, 29 November 2012
![]() |
Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||
![]() | |||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system that was originally designed by Josh Perfetto and Tito Jankowski.
Key Features
ProtocolsMaterials
PCR Protocol 1.) Pipet 0.1μL of template DNA, 0.5μL of 10μM forward primer, 0.5μL of 10μM reverse primer, 25.0μL of GoTaq Master Mix, and 23.9μL of dH20 in an Eppendorf tube. All of these items mixed together should create a total volume of 50.0μL. DNA Measurement Protocol Fluorimeter Setup Fluorimeter Measurements ImageJ Instructions Research and DevelopmentBackground on Disease Markers The single nucleotide polymorphism (SNP), 137852571, that is being examined in this experiment is linked with Androgen Insensitivity Syndrome and Kennedy Spinal and Bulbar Muscular Atrophy. Androgen Insensitivity Syndrome occurs when a person who is genetically male (who has one X and one Y chromosome) is resistant to male hormones (called androgens). As a result, the person has some or all of the physical traits of a female, but the genetic makeup of a male. The mutation on the X chromosome makes the body unable to respond to the hormones that produce a male appearance. Kennedy Spinal and Bulbar Muscular Atrophy is a debilitating neurodegenerative disease resulting in muscle cramps and progressive weakness due to degeneration of motor neurons in the brain stem and spinal cord. The SNP is located on the X chromosome and affects the gene AR, the gene is inherited in an x-linked recessive manner therefore only males can be fully affected by the mutation and females are rarely affected. The sequence of this gene is:
Normal: G mutates into cancer A |