IGEM:Paris Bettencourt 2012/Notebooks/RE group/Construction design: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
Claire Mayer (talk | contribs) No edit summary |
||
| (43 intermediate revisions by 3 users not shown) | |||
| Line 4: | Line 4: | ||
#* Full: [[http://www.ncbi.nlm.nih.gov/nuccore/323650450 Frankia sp. Eul1b FseI restriction-modification system gene cluster, complete sequence]] | #* Full: [[http://www.ncbi.nlm.nih.gov/nuccore/323650450 Frankia sp. Eul1b FseI restriction-modification system gene cluster, complete sequence]] | ||
#* Without methyltransferase: [[http://www.ncbi.nlm.nih.gov/nuccore/323650450?from=1529&to=2188&report=gbwithparts Frankia sp. Eul1b FseI restriction-modification system gene cluster, complete sequence]] | #* Without methyltransferase: [[http://www.ncbi.nlm.nih.gov/nuccore/323650450?from=1529&to=2188&report=gbwithparts Frankia sp. Eul1b FseI restriction-modification system gene cluster, complete sequence]] | ||
# Check usage in | # Check usage in ''E.Coli'' | ||
# Check the lack of: | # Check the lack of: | ||
#* ''EcoRI'' ''' | #* ''EcoRI'' '''[E]''' | ||
#* ''Xbal'' ''' | #* ''Xbal'' '''[X]''' | ||
#* ''SpeI'' ''' | #* ''SpeI'' '''[S]''' | ||
#* ''PstI'' ''' | #* ''PstI'' '''[P]''' | ||
#* ''FseI'' | #* ''FseI'' | ||
# | # [https://bioinfo.invitrogen.com/geneartgenes/projectmgmt Codon optomozation] | ||
# ATG...TAA | # ATG...TAA | ||
# Salis Lab Calculator (not the strongest RBS) | # [https://salis.psu.edu/ Salis Lab Calculator] (not the strongest RBS) | ||
We are planing '''''FokI''''' restriction site to devide sequence (almost in the middle). | We are planing '''''FokI''''' restriction site to devide sequence (almost in the middle). | ||
==RBS_FseI gBlocks construct== | |||
===Complete Construct=== | |||
[[Image:RBS_FseI.png|frameless|upright=4.5|Figure 1 : RBS_FseI Complete Construct]] | |||
[[Media:RBS_FseI.geneious]] | |||
===Fragments 1=== | |||
[[Image:RBS_FseI_frag1.png|frameless|upright=4.5|Figure 2 : RBS_FseI fragment 1]] | |||
[[Media:RBS_FseI_frg1.geneious]] | |||
===Fragements 2=== | |||
[[Image:RBS_FseI_frag2.png|frameless|upright=4.5|Figure 3 : RBS_FseI fragment 2]] | |||
[[Media:RBS_FseI_frg2.geneious]] | |||
==RBS_IsceI gBlocks construct== | |||
===Complete Construct=== | |||
[[Image:RBS_ISceI.png|frameless|upright=4.5|Figure 4 : RBS_ISceI Complete Construct]] | |||
[[Media:RBS_IsceI.geneious]] | |||
===Fragments 1=== | |||
[[Image:RBS_ISceI_frag1.png|frameless|upright=4.5|Figure 5 : RBS_ISceI fragment 1]] | |||
[[Media:RBS_IsceI_frg1.geneious]] | |||
===Fragements 2=== | |||
[[Image:RBS_ISceI_frag2.png|frameless|upright=4.5|Figure 6 : RBS_ISceI fragment 2]] | |||
[[Media:RBS_IsceI_frg2.geneious]] | |||
=Sequences= | |||
===Prefix 1=== | |||
Before sequences starting with ATG | |||
<code>GAATTCGCGGCCGCTTCTAG</code> | |||
===Prefix 2=== | |||
Before sequences starting with '''no''' ATG | |||
<code>GAATTCGCGGCCGCTTCTAGAG</code> | |||
===Suffix=== | |||
<code>TACTAGTAGCGGCCGCTGCAG</code> | |||
== Plasmid 1 : pSB3C5_Pbad_RBS_FseI== | |||
*pbad : [http://partsregistry.org/Part:BBa_I13453 BBa_I13453] | |||
*RBS : [http://partsregistry.org/Part:BBa_B0032 BBa_B0032] | |||
*FseI: [http://www.ncbi.nlm.nih.gov/nuccore/JF323049.1] | |||
We used gBlocks to synthetize RBS_FseI | |||
Geneious file : [[Media:Plasmid_Pbad_RBS_FseI.geneious]] (right click) | |||
== Plasmid 2 : pSB3C5_Pbad_RBS_IsceI== | |||
*pbad : [http://partsregistry.org/Part:BBa_I13453 BBa_I13453] | |||
*RBS : [http://partsregistry.org/Part:BBa_B0032 BBa_B0032] | |||
*IsceI: | |||
We used gBlocks to synthetize RBS_IsceI | |||
Geneious file : [[Media:Plasmid_Pbad_RBS_IsceI.geneious]] (right click) | |||
== Plasmid 3 : pSB3C5_Plac_RBS_FseI== | |||
*Plac : [http://partsregistry.org/Part:BBa_R0011 BBa_R0011] | |||
*RBS : [http://partsregistry.org/Part:BBa_B0032 BBa_B0032] | |||
*FseI: [http://www.ncbi.nlm.nih.gov/nuccore/JF323049.1] | |||
We used gBlocks to synthetize RBS_FseI | |||
Geneious file : [[Media:Plasmid_Plac_RBS_FseI.geneious]] (right click) | |||
== Plasmid 4 : pSB3C5_Plac_RBS_IsceI== | |||
*plac : [http://partsregistry.org/Part:BBa_R0011BBa_R0011] | |||
*RBS : [http://partsregistry.org/Part:BBa_B0032 BBa_B0032] | |||
*IsceI: | |||
We used gBlocks to synthetize RBS_IsceI | |||
Geneious file : [[Media:Plasmid_Plac_RBS_IsceI.geneious]] (right click) | |||
Latest revision as of 14:39, 9 July 2012
Fse gene (gBlocks Gene Fragments)
- Gene sequence
- Check usage in E.Coli
- Check the lack of:
- EcoRI [E]
- Xbal [X]
- SpeI [S]
- PstI [P]
- FseI
- Codon optomozation
- ATG...TAA
- Salis Lab Calculator (not the strongest RBS)
We are planing FokI restriction site to devide sequence (almost in the middle).
RBS_FseI gBlocks construct
Complete Construct
Fragments 1
Fragements 2
RBS_IsceI gBlocks construct
Complete Construct
Fragments 1
Fragements 2
Sequences
Prefix 1
Before sequences starting with ATG
GAATTCGCGGCCGCTTCTAG
Prefix 2
Before sequences starting with no ATG
GAATTCGCGGCCGCTTCTAGAG
Suffix
TACTAGTAGCGGCCGCTGCAG
Plasmid 1 : pSB3C5_Pbad_RBS_FseI
- pbad : BBa_I13453
- RBS : BBa_B0032
- FseI: [1]
We used gBlocks to synthetize RBS_FseI
Geneious file : Media:Plasmid_Pbad_RBS_FseI.geneious (right click)
Plasmid 2 : pSB3C5_Pbad_RBS_IsceI
- pbad : BBa_I13453
- RBS : BBa_B0032
- IsceI:
We used gBlocks to synthetize RBS_IsceI
Geneious file : Media:Plasmid_Pbad_RBS_IsceI.geneious (right click)
Plasmid 3 : pSB3C5_Plac_RBS_FseI
We used gBlocks to synthetize RBS_FseI
Geneious file : Media:Plasmid_Plac_RBS_FseI.geneious (right click)
Plasmid 4 : pSB3C5_Plac_RBS_IsceI
We used gBlocks to synthetize RBS_IsceI
Geneious file : Media:Plasmid_Plac_RBS_IsceI.geneious (right click)





