IGEM:MIT/2006/Notebook/2006-7-18: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Stephen (talk | contribs)
Stephen (talk | contribs)
Line 19: Line 19:




5'=tctagaggcttatgttttcgctgatatcccgagcggtttcaaaattgtgatctatatttaacaaatactagtagcggccgctgca-3'
5'-ctagaggcttatgttttcgctgatatcccgagcggtttcaaaattgtgatctatatttaacaaatactagtagcggccgctgca-3'
 
Length: 84 bases
 
GC Content: 41.7%
 
Melting Temperature: 69.7 degrees Celsius


Complementary Strand:
Complementary Strand:
Line 25: Line 31:


5'-GCGGCCGCTACTAGTATTTGTTAAATATAGATCACAATTTTGAAACCGCTCGGGATATCAGCGAAAACATAAGCCT-3'
5'-GCGGCCGCTACTAGTATTTGTTAAATATAGATCACAATTTTGAAACCGCTCGGGATATCAGCGAAAACATAAGCCT-3'
Length: 76 bases
GC Content: 40.8%
Melting Temperature: 69.1 degrees Celsius
Heterodimer DeltaG: -161.93 kcal/mol


Also, I contacted Professor Schellhorn last night inquiring about a plasmid containing osmY or the sequences of the primers he used to PCR osmY out of E. coli.
Also, I contacted Professor Schellhorn last night inquiring about a plasmid containing osmY or the sequences of the primers he used to PCR osmY out of E. coli.

Revision as of 18:22, 18 July 2006

Transformants

  1. IK control did not grow, though BSMT and BAMT grew
  2. ATF1 and Top10 control grew as well
    • Next step is liquid culture all of them, and miniprep on ATF1
  3. SAMTC connected to both RBSs grew along with SAMTA connected to both RBSs and the control.

Meeting

  • Tomorrow: Sequence: 4 SAMT-C connected to rbs & term-30, and 4 SAMT-C connected to rbs & term-32
  • end of the day: Liquid culture all transformants (Duda. BAMT in indole-knockout, Duda. BSMT in indole-knockout, the two above)
  • Make liquid culture from the glycerols of the constitutive promoters
  • Veena: miniprep pCHBA, sequence it with primers from Reshma
  • Andre- request plasmid for vanilla
  • maybe: re-cut miniprepped BSMT
  • research exponential phase promoter

Annealing Parts for Synthesis of the osmY Promoter

Forward Strand:


5'-ctagaggcttatgttttcgctgatatcccgagcggtttcaaaattgtgatctatatttaacaaatactagtagcggccgctgca-3'

Length: 84 bases

GC Content: 41.7%

Melting Temperature: 69.7 degrees Celsius

Complementary Strand:


5'-GCGGCCGCTACTAGTATTTGTTAAATATAGATCACAATTTTGAAACCGCTCGGGATATCAGCGAAAACATAAGCCT-3'

Length: 76 bases

GC Content: 40.8%

Melting Temperature: 69.1 degrees Celsius

Heterodimer DeltaG: -161.93 kcal/mol

Also, I contacted Professor Schellhorn last night inquiring about a plasmid containing osmY or the sequences of the primers he used to PCR osmY out of E. coli.