MurrayRM:PURExpress system notes and experience: Difference between revisions
| (8 intermediate revisions by the same user not shown) | |||
| Line 27: | Line 27: | ||
<blockquote> | <blockquote> | ||
==== PLG1 ==== | ==== PLG1 - plasmid LacI-repressible GFP ==== | ||
This construct is part of the biobricks library and will be obtained from freezer stocks at Stanford (e-mail to Drew on 12 Feb confirming existence). | This construct is part of the biobricks library and will be obtained from freezer stocks at Stanford (e-mail to Drew on 12 Feb confirming existence). | ||
==== LLG2 ==== | ==== LLG2 - linear LacI-repressible GFP ==== | ||
This is linear DNA containing a lacI-repressible T7 promoter in front of GFP, extracted from BBa_I2035 using a simple forward and reverse primer. Use of this piece of DNA allows testing of linear DNA versus plasmid DNA. | This is linear DNA containing a lacI-repressible T7 promoter in front of GFP, extracted from BBa_I2035 using a simple forward and reverse primer. Use of this piece of DNA allows testing of linear DNA versus plasmid DNA. | ||
| Line 78: | Line 78: | ||
RFP sequence (for Karsten's plasmid) | RFP sequence (for Karsten's plasmid) | ||
<blockquote><tt> | <blockquote><tt> | ||
ATGTCCAGATTAGATAAAAGTAAAGTTGCGAGCTCTgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcg | |||
aaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaa | |||
agcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactc | |||
ctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacc | |||
cggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtg | |||
cttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa | |||
</tt></blockquote> | </tt></blockquote> | ||
| Line 86: | Line 91: | ||
</tt></blockquote> | </tt></blockquote> | ||
* | * RMM_LLR4_fwd_oneshot: tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactag ATGTCCAGATTAGATAAAAG | ||
** Does not include the GAAAT sequence that is at the start of the PURE universal primer | ** Does not include the GAAAT sequence that is at the start of the PURE universal primer | ||
* RMM_LLR4_rev: TATTCA ttattaagcaccggtggagtgac | * RMM_LLR4_rev: TATTCA ttattaagcaccggtggagtgac | ||
** Initial sequence based on specification in PURExpress manual | ** Initial sequence based on specification in PURExpress manual | ||
Alternative: do in two rounds | |||
* RMM_LLR4_fwd_round1: tactagagtcacacaggaaagtactag ATGTCCAGATTAGATAAAAG (47 bp, 36% GC) | |||
** Starts just after the lacI operator sites and goes through RBS, then beginning of RFP | |||
* RMM_LLR4_fwd_round2: tcatacgactcactataggggaattgtgagcggataacaattcccctggatcc tactagagtcacacagg (70 bp, 47% GC) | |||
** Includes the T7 promoter, through the lacI operator site and overlaps with the RBS sequence | |||
==== PLR5 ==== | ==== PLR5 ==== | ||
| Line 96: | Line 107: | ||
* BamH1: GGATCC | * BamH1: GGATCC | ||
* XhoI: CTCGAG | * XhoI: CTCGAG | ||
* RMM_PLR5_fwd_BamH1: GGAA GGATCC | * RMM_PLR5_fwd_BamH1: GGAA GGATCC ATGTCCAGATTAGATAAAAG | ||
** Added GGAA to end of sequence per Simon | ** Added GGAA to end of sequence per Simon | ||
* RMM_PLR5_rev_XhoI: GGAA CTCGAG ttattaagcaccggtggagt | * RMM_PLR5_rev_XhoI: GGAA CTCGAG ttattaagcaccggtggagt | ||
** Added GGAA to end of sequence per Simon | ** Added GGAA to end of sequence per Simon | ||
==== LCR6 ==== | |||
This is a linear sequence of DNA that pulls out RFP for use in the PURE system. Replacement for previous sequence that was not quite right. | |||
* RMM_LCR6_fwd_round1: TAACTTTAAGAAGGAGATATACCA ATGTCCAGATTAGATAAAAG (44 bp, 30% GC) | |||
* RMM_LCR6_rev_round1: TATTCA ttattaagcaccggtggag (25 bp, 40% GC) | |||
</blockquote> | </blockquote> | ||
Latest revision as of 00:17, 13 February 2010
Notes on using the NEB PURExpress system.
Worked example: inducible expression
To illustrate how the system works, I am going to try various combinations of three different constructs:
- PLG1 (BBa_I2035) - GFP with a LacI-repressible promoter on a plasmid
- LLG2 (T7-Plac:RBS:GFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from BBa_I2035
- LCL3 (T7:RBS:lacI) - linear lacI on a constitutive T7 promoter
In addition, I may build up an RFP-based construct, just in case I can't get access to BBa_I2035. This requires two additional constructs:
- LLR4 (T7-Plac:RBS:RFP) - linear DNA with RFP on a LacI-repressible promoter, PCR'd from the purified RFP plasmid (based on plasmids provided by Karsten Temme at UCSF), created by extension PCR
- PLR5 (T7-Plac:RBS:RFP) - plasmid DNA with RFP on a LacI-repressible promoter, PCR'd from the purified RFP plasmid (based on plasmids provided by Karsten Temme at UCSF) and inserted into Novagen pET vector. This can be used as a replacement for PLG1, if needed.
Naming scheme:
- L/P - DNA type: linear DNA versus plasmid
- C/L - promoter type: constitutive T7 promoter versus LacI-repressible
- G/L/R - coding region: GFP, RFP or LacI
Using these components, I can try out the following "circuits":
- GFP expression on a lacI-repressible T7 promoter (with no lacI => should flouresence): PLG1 or LLG2
- This will allow a positive control to make sure that a T7 promoter with operator site still works
- Repression of GFP by lacI: PLG1/LLG2 + LCL3
- Induction of GFP using IPTG: PLG1/LLG2 + LCL3
DNA construction
Only the BBa_I2035 plasmid is in the form needed for use with the PURE system. The other sequences will be constructed using PCR-based editing.
PLG1 - plasmid LacI-repressible GFP
This construct is part of the biobricks library and will be obtained from freezer stocks at Stanford (e-mail to Drew on 12 Feb confirming existence).
LLG2 - linear LacI-repressible GFP
This is linear DNA containing a lacI-repressible T7 promoter in front of GFP, extracted from BBa_I2035 using a simple forward and reverse primer. Use of this piece of DNA allows testing of linear DNA versus plasmid DNA.
The sequence for the relevant section of BBa_I2035, starting from the beginning of the promoter and going through the end of the terminator
>BBa_I2035 Part-only sequence (856 bp) tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactagatgcgtaaaggagaagaact tttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacgga aaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagat acccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaa gacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa ttggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatg gaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccct ttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa tactagagctagcataaccccttggggcctctaaacgggtcttgaggggttttttg
- RMM_LLG2_fwd: tcatacgactcactataggggaat
- RMM_LLG2_rev: caaaaaacccctcaagacccgttt
LCL3
This sequence consists of lacI on a constitutive T7-promoter. It is constructed by doing PCR amplification of lacI out of a BBa_K091121 plasmid and then attaching the T7 promoter and RBS using the PURExpress universal primer. Sequence for lacI (from BBa_K091121 - wild type lacI):
>BBa_K091121 Part-only sequence (1083 bp) atgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaa cgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgc cacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaa cgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgcca ttgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtac gcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggc tggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctga atgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcgga tatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagc gtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaata cgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtga
- RMM_LCL3_fwd_round1: TAACTTTAAGAAGGAGATATACCA atgaaaccagtaacgttatacg
- Based on specification in PURExpress manual, with start of lacI
- RMM_LCL3_rev_round1: TATTCA tcactgcccgctttccagt
- Based on specification in PURExpress manual
- Round 2 forward primer: PURExpress universal forward primer
- Round 2 reverse primer: same as round 1 reverse primer
LLR4
A linear sequence of DNA with a T7 LacI-repressible promoter followed by RBS and RFP. This will be constructed using PCR extension off of RFP.
RFP sequence (for Karsten's plasmid)
ATGTCCAGATTAGATAAAAGTAAAGTTGCGAGCTCTgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcg aaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaa agcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactc ctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacc cggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtg cttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataa
T7:Plac:RBS sequence
tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactag
- RMM_LLR4_fwd_oneshot: tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactag ATGTCCAGATTAGATAAAAG
- Does not include the GAAAT sequence that is at the start of the PURE universal primer
- RMM_LLR4_rev: TATTCA ttattaagcaccggtggagtgac
- Initial sequence based on specification in PURExpress manual
Alternative: do in two rounds
- RMM_LLR4_fwd_round1: tactagagtcacacaggaaagtactag ATGTCCAGATTAGATAAAAG (47 bp, 36% GC)
- Starts just after the lacI operator sites and goes through RBS, then beginning of RFP
- RMM_LLR4_fwd_round2: tcatacgactcactataggggaattgtgagcggataacaattcccctggatcc tactagagtcacacagg (70 bp, 47% GC)
- Includes the T7 promoter, through the lacI operator site and overlaps with the RBS sequence
PLR5
This is a linear sequence of DNA that can be used as a replacement for LLG2, in case I can't get BBa_I2035. In order to get this sequence, I have to insert RFP into a pET vector (has a lacI-repressible T7 promoter) and grow up some cells.
- Restriction enzymes to be used: TBD (waiting to find out which pET vectors we actually have available)
- BamH1: GGATCC
- XhoI: CTCGAG
- RMM_PLR5_fwd_BamH1: GGAA GGATCC ATGTCCAGATTAGATAAAAG
- Added GGAA to end of sequence per Simon
- RMM_PLR5_rev_XhoI: GGAA CTCGAG ttattaagcaccggtggagt
- Added GGAA to end of sequence per Simon
LCR6
This is a linear sequence of DNA that pulls out RFP for use in the PURE system. Replacement for previous sequence that was not quite right.
- RMM_LCR6_fwd_round1: TAACTTTAAGAAGGAGATATACCA ATGTCCAGATTAGATAAAAG (44 bp, 30% GC)
- RMM_LCR6_rev_round1: TATTCA ttattaagcaccggtggag (25 bp, 40% GC)