User:Adam Nolan/Notebook/Biology 210 at AU
Start of Notebook
First entry. I'm able to effectively write content in this notebook.
January 14, Lab 1 - Biological Life at AU.
In this lab, the goal was to analyze a specific ecosystem that appears on AU’s campus in a 20 by 20 meter transect of land. The transect we were assigned was the marshland, which was located outside the tunnel, near the road, across the street from the Katzen arts center. We mapped the area, and samples of of vegetation and soil were taken. We attempted to capture as much of the diversity of the area was we could in our sample. That includes both biotic and abiotic samples. The marshland was rich with vegetation and was very moist. Because it was winter, there was snow littered throughout the area. The west and southwest ends of the marsh were very rocky, while the north and northeast areas were muddy and had lots of taller plants. Large stones were scattered throughout the marsh. Cattails ran along the center of the transect. On the western most corner was a sewer grate where water drained. We recorded what biotic and abiotic factors we found.
Abiotic factors included:
Rocks, metal (sewer grate), soil, light, snow, air, ice.
Biotic factors included:
Grass, moss, cattails, weeds, clovers, cardinal flowers, straw plants, and various shrubs.
After obtaining our sample and mapping the area, we returned to the lab and made a hay-infusion culture with the sample we collected. The hay infusion culture was made by placing 12 grams of our sample into a plastic jar with 500mLs of water. .1gm of dried milk was added, and the solution was gently mixed for 10 seconds. After that it was left uncovered for a week for later observation.
Fig. 1 - A sketch of the marsh transect
January 21, Lab 2 – Identifying Algae and Protists
In this lab, the goal was to analyze the different types of cells present in the hay infusion culture we made in the previous lab from samples we obtained from the marshland transect. We took drops from the top layer of the culture and another from the bottom. Both drops were made into wet mounts and viewed under a microscope in order to identify different types of cells living within. The hay infusion culture smelled rancid, like hot sewage. The water was a yellow color, and a fine layer of silt had collected along the bottom of the jar. A whitish film had developed over the top of the water, and the vegetation from the sample floated near the bottom. The plants were still green, so we could assume they were still alive. The film at the top of the water appeared to be some sort of mold, which we also categorized as alive. The first sample we took was from the very top of the jar, just underneath the moldy film so that water could be drawn out. From the sample, we identified three different types of organisms.
Our hay infusion culture.
Sample 1:
Paramecium Bursaria
-100µm
-Motile
-Green color indicates photosynthesis
-This organism is able to survive in its environment because it’s able to obtain energy (photosynthesis) and move around to get to areas where energy will be most available.
Pandorina
-70µm
-Organized into a colony
-Not motile
-Didn’t appear to use photosynthesis
Blepharisma sp.
-450µm
-Purple color
-Not motile
-No photosynthesis.
Sample 2:
Sample 2 was obtained near the bottom of the jar. Some silt was taken up along with the water.
Ameoba Proteus
-20µm
-Moving/sprouting (motile)
-No photosynthesis
-No color (clear)
Paramecium Bursaria
-50µm
-Motile
-Used photosynthesis (green color)
Colpidium
-60µm
-Motile
-No photosynthesis
-Clear color
January 28, Lab 3 - Microbiology
Week 3, we examined the growth on the agar plates that had developed from the hay infusion over the previous week. Below is a chart labeled "table 1" showing the colonies grown and on which type of plate, followed by photos of our agar plates.
The table shows that there are clearly higher amounts of colony/bacteria growth on the nutrient agar plants without the tet antibiotic, indicating that the antibiotic did work to some capacity, inhibiting bacteria growth.
Fig. 1 - Our nutrient agar plates without the tet antibiotic.
Fig. 2 - Our nutrient agar plates with the tet antibiotic. Gray/black patches are mold and were not sampled..
After identifying the amount of colonies on each plate and their type, we could conclude that there were many more able to grow on the nurtrient agar plates that didn't have the tet antibiotic. This would indicate that the antibiotic had a significant effect on the growth of bacteria on the plates, however, because some of the tet plates did have growth, that shows that there are some resistant strains of bacteria that were still able to grow, albeit in smaller amounts.
In order to observe the bacteria, we had them undergo a gram stain procedure. To get the bacteria samples from the agar plates, a metal loop was sterilized over a flame and used to scrape colonies from the plates. The samples were then mixed into drops of water on four separate slides. The four slides were then passed through the flame three times in order to evaporate the water. The slides were placed on a staining tray and covered with crystal violet dye for one minute, then rinsed off with water. Then, they were then covered with Gram’s iodine mordant for another minute, before washed with water once more. To decolorize the smears, the slides were flooded with 95% alcohol for 20 seconds, and then rinsed with water. The smears were covered with safranin stain for 30 seconds, and then rinsed with water again. Excess water was dried off using kimwipes. After a few minutes of additional air drying, the gram stains were observed with a microscope in low and high magnifications.
Fig 3. The gram-stain slides.
Below is "table 2" characterizing the bacteria visible on our gram stains using the microscope:
We have found that there is a clear difference in colony growth between the two types of plates, indicating that the tet antibiotic had a negative effect on the colony growth of bacteria. Because there was some colony growth in the tet plates though, we can conclude that there are some bacteria living within the hay infusion culture that are resistant to this type of antibiotic. Those colonies that did grow on the tet plates are those antibiotic bacteria.
February 4, Lab 4 - Plants and Fungi
The purpose of this lab was to examine the different types of plant life within our transect, as well as identify them and their various structures such as reproductive methods, vascularization, and otherwise specialized structures.
We did this by going out to the marsh transect with three ziploc bags and gathering as many different types of samples of plants. The plants we obtained were: Moss, hay, cattail, and samples from a "butterfly bush," as well flowering bush. Photos of all of these samples were taken as well. From there, the plants were examined in the lab. We searched each looking for the reproductive method used by the plant, specialized structures, and we cut small sections off to observe under the microscope in order to determine the vascularization of the plant. All findings were recorded in our journals and made into the table below:
In addition to the table, pictures of each plant were taken, as can be seen below:
Figure 1. Flowering Bush.
Figure 2. Cattail Plant.
Figure 3. Hay
Figure 4. Moss
Figure 5. Butterfly Bush.
It's clear that there are many diverse types of plants within just our transect alone. Plants of varying vascularizations, reproductive methods, and special structures. By investigating these organisms, we can gain insight into how each contributes to their environment and ecosystem, and how long they've come via evolution based on the types of complex structures each have developed.
February 11, Lab 5 - Invertebrates and Vertebrates
The purpose of this lab was to further explore the level of diversity of life within the marsh transect. This time, we went beyond plants and bacteria, and looked at different types of vertebrates and invertebrates. First, we broke down our Berlese funnels which we had made the previous week using 500g of leaf litter taken from our marsh transect. This sample came from an area of soft soil covered with dead leaves. In the lab, a Berlese Funnel was then constructed for this leaf litter. First, 25 mL of a 50:50 ethanol/water solution was poured into a 50 mL conical tube. Screening material was then attached to the bottom of the funnel using tape to keep leaves and other large matter from falling into the solution. The leaf litter sample was then placed into the funnel. Next, the funnel was placed in a ring stand, with its lower shoot attached to the conical tube sealed with parafilm. The entire assemly was placed beneath a lit 40 watt lamp, with the light about 1-2 inches from the sample. The lamps and funnels were then covered with foil and left for the week.
To find the invertebrates, we took apart our Berlese funnels and obtained samples from the ethanol/water solution at the bottom that had been collecting falling matter from the litter sample. We took a small sample from the top of the solution, as well as from the bottom. Both samples of the liquid were placed in petri dishes and examined under a microscope for invertebrates. All findings were catalogged, and can be seen in the table below:
All invertebrates were found at the bottom of our solution, and varied from 1250-2500µm in size.
After investigating the invertebrates present in our sample, we researched the different types of vertebrates present within our marsh transect. We identified five different types of vertebrates, and they can be found in the list below:
- The Eastern Grey Squirrel (Sciurus carolinensis) Phylum: Chordata; Class: Mammalia; Order: Rodentia; Family: Sciuridae; Genus: Sciurus; Species: S. carolinensis
- The Field Sparrow (Spizella pusilla) Phylum: Chordata; Class: Aves; Order: Passeriformes; Family: Emberizidae; Genus: Spizella; Species: S. pusilla
- The American Robin (Turdus migratorius) Phylum: Chordata; Class: Aves; Order: Passeriformes; Family: Turdidae; Genus: Turdus; Species: T. migratorius
- The Common Garter Snake (Thamnophis sirtalis) Phylum: Chordata; Class: Reptilia; Order: Squamata; Family: Colubridae; Genus: Thamnophis; Species: T. sirtalis
- The Northern Short-tailed Shrew (Blarina brevicauda) Phylum: Chordata; Class: Mammalia; Order: Soricomorpha; Family: Soricidae; Genus: Blarina; Species: B. brevicauda
With this this data, we were able to construct a food web for our transect.
As we gather more information about the transect, the more we're able to understand how diverse this small plot of land actually is, and how much each organism contributes to forming this ecosystem. We're given a larger perspective about the importance of each living thing in the ecosystem, and how each interacts with the others on different levels.
February 25, Lab 7 - PCR Sequencing
During the bacteria lab in week 3, we took samples from the bacterial colonies that we grew on the agar plates. We took two samples from the tet agar plates, and from two the plates without the antibiotic. The samples we collected went through a PCR reaction and then placed into to the electrophoresis gel to see which contained the 16s gene sequences. After that, the colonies which exhibited the 16s sequence were sent to get sequenced. Below is a figure of our electrophoresis gel.
Once the sequences were finished PCR, we were able to see the which sample had which bacteria by using the nucleotide BLAST program.
Here are the following sequences for the two genetic samples.
1. Sample 1 Sequence: 97% match with Pseudomonas
(NNNNNNNNNNNNNNNNTGCAGTCGAGCGGANGANGGGAGCTTGCTCCTGGATTCAGCGGCGGACGGGTGAGTNNNGNCTA GGAATCTGCCTGGTAGTGGGGGACAACGTTTCGAAAGGAACGCTAATACCGCATACGTCCTACGGGAGAAAGCAGGGGAC CTTCGGGCCTTGCGCTATCAGATGAGCCTAGGTCGGATTAGCTTGTTGGTGAGGTAATGGCTCACCAAGGCGACGATCCG TAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATA TTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGG GAGGAAGGGTTGTAGATTAATACTCTGCAATTTTGACGTTACCGACAGAATAAGCACCGGCTAACTCTGTGCCAGCAGCC GCGGTAATACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTG AAAGCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGGCAAGCTAGAGTACGGTAGAGGGTGGTGGAATTTCCTGTGT AGCGGTGAAATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACCACCTGGACTGATACTGACACTGAGGTGCGA AAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTNNCGATGTCAACTAGCCGTTGGAATCCTTGAGA TTTTAGTGGCGCAGCTAACGCATTAAGTTGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTGACGGG GGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGAANAANCTTANCNNNCTTGACATGCANANAACTT TCCANANATGGATTGGNGCCTTCGGNAACTCTGACNCAGNGCTGCATGNNNGNTCGTCAGCTCGTGTCGTGAGANNNTGN NTNAGTCCCGNTANCNANCGNNNNNCNNGTCCNTANTNNNCAGCNNNTTNTGNNN)
The description for this species is: Gram negative, rod shaped, motile, aerobic, and in favor of watery conditions.
2. Sample 2 Sequence: 98% match with Ralstonia
(NNNNNNNNNNTNNNNNNNNNNNAGTCGNNCGGCANCNNGATCTAGCTTGCTAGATTGATGGCGAGTGGCGAACGGGTGAG TAATACATCGGAACGTGCCCTGTAGTGGGGGATAACTAGTCGAAAGATTAGCTAATACCGCATACGACCTGAGGGTGAAA GTGGGGGACCGCAAGGCCTCATGCTATAGGAGCGGCCGATGTCTGATTAGCTAGTTGGTGGGGTAAAGGCCCACCAAGGC GACGATCAGTAGCTGGTCTGAGAGGACGATCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAGCAG TGGGGAATTTTGGACAATGGGCGAAAGCCTGATCCAGCAATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACT TTTGTCCGGAAAGAAATGGCTCTGGTTAATACCTGGGGTCGATGACGGTACCGGAAGAATAAGGACCGGCTAACTACGTG CCAGCAGCCGCGGTAATACGTAGGGTCCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTGTGCAAG ACCGATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTGGTGACTGCACGGCTAGAGTGTGTCAGAGGGGGGTAGAAT TCCACGTGTAGCAGTGAAATGCGTAGAGATGTGGAGGAATACCGATGGCGAAGGCAGCCCCCTGGGATAACACTGACGCT CATGCACGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCCTAAACGATGTCAACTAGTTGTTGGG GATTCATTTCCTTAGTAACGTANCTAACGCGTGAAGTTGACCGCCTGGGGAGTACGGTCGCAAGATTAAAACTCAAAGGA ATTGACGGGGACCCGCACAAGCGGTGGATGATGTGGATTAATTCGATGCAACGCGAAAAACCTTACCTACCCTTGACATG CCACTAACGAAGCANANATGCATTANGTGCTCNAAAGAGAAAGTGGANNCNNNGCTGCATGGCTGTCGTCAGCNNCGTGT CGTGANNATGTTNGGGTTAAGTCCCCGCAACGAGCNNCANCCCTTGTCTNCTAGTTGCNNN)
There was not much known about the Ralstonia, but it is known that they belong to the Proteobacteria genus. Proteobacteria can be both non-motile or motile. Additionally, they are gram negative, and anaerobic.
With this information, we are able to understand more about the organisms within our transect on a genetic level.



















