BME103:T930 Group 7 l2

BME 103 Fall 2012	Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Student: Elyse Candell Role(s: Machine Engineer) Name: Student Role(s) Name: Student Role(s) Name: Student Role(s) Name: Student Role(s) LAB 2 WRITE-UP Thermal Cycler Engineering Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design Key Features Instructions Protocols Materials Supplied in the Kit Amount Test Tubes 32 Micropipette (10uL-100uL) 1 Disposable Pipette tips 100 PCR Reaction Mix 2 mL Supplied by User Amount Smartphone or Computer 1 Bluetooth Capability in Phone 1 USB Cord with Computer 1 Patient Samples 50 uL per Test Tube PCR Protocol DNA Measurement Protocol Research and Development Background on Disease Markers rs74315509 This SNP is linked to schizophrenia. http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=74315509 Primer Design forward primer: AGGGGGGCCAGGGCCTCAGTG reverse primer: TGCCTTCCGC A CGAGCCCGTC The disease allele will give a PCR product because it will attach to the primer in the PCR, thus replicating exponentially. A non-diesease allele will not attach to the primer, so the DNA can not replicate exponentially. Illustration