840:153g:Projects/project4/2009/03/26

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png MoldBusters' Journal Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Thursday 3/26

Oggie

  • Diluted primers from 100μM to 10μM concentrations.
  • Setup a gradient for the 3 different forward primers in order to obtain optimal annealing temperature.
  • Each primer was tested individually as well as in combination with the reverse primer to test for dimers.

Josh and Casy

  • Discussed PCR running conditions for Tuesday when new primers arrive.
  • The PCR will be run with 1μL and 0.1μL of DNA. The temperatures that will range from 45°C, 50°C, 55°C, and 60°C.
  • The new primers contain a point mutation that will eliminate hairpin formation.
    Forward Primer:
       5’ TAGAATTCGCGGCCGCTTCTAG ATGAG(G)AGCAAAAAATTGTGG
    Reverse Primer:
       5’ ATCTGCAGCGGCCGCTACTAGTA TTATTGTGCAGC(A)GCTTGTAC

Derek and Katy

  • Ran a second PCR amplification of wintergreen because our first attempt didn't work well.
  • Next class we will run a gel to see if we get better results with this attempt.