Thursday 3/26
Oggie
- Diluted primers from 100μM to 10μM concentrations.
- Setup a gradient for the 3 different forward primers in order to obtain optimal annealing temperature.
- Each primer was tested individually as well as in combination with the reverse primer to test for dimers.
Josh and Casy
- Discussed PCR running conditions for Tuesday when new primers arrive.
- The PCR will be run with 1μL and 0.1μL of DNA. The temperatures that will range from 45°C, 50°C, 55°C, and 60°C.
- The new primers contain a point mutation that will eliminate hairpin formation.
Forward Primer:
5’ TAGAATTCGCGGCCGCTTCTAG ATGAG(G)AGCAAAAAATTGTGG
Reverse Primer:
5’ ATCTGCAGCGGCCGCTACTAGTA TTATTGTGCAGC(A)GCTTGTAC
Derek and Katy
- Ran a second PCR amplification of wintergreen because our first attempt didn't work well.
- Next class we will run a gel to see if we get better results with this attempt.
|
MoldBusters' Journal
Main project page
Previous entry Next entry
