840:153g:Projects/project3/2009/03/26

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Tear Inducing Bacteria Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

March 26, 2009

  • Today we ran our RNA gel using the Formaldehyde Agarose Gel Electrophoresis for RNA. From the results, we were able to confirm that we did extract RNA from our onion tissue.
  • Today we designed new primers using out old ones but without the extensions. We also designed new primers further from our gene of interest. This way we will capture our gene and a little extra (about 3500 basepairs - our gene of interest is about 1817 bps long). We designed our primers using the IDT website: [1]

Using our previous primers:

   OnionP1: 5’- atggagtcttaccacaaagt -3’
   OnionP2: 5’- atg aaggtgacatggagtttgaa -3’
   OnionR1: 5’- ttaaatgaaaggacggcggg-3'

Our newly designed primers:

   OnionP3:  5'- ACTCGTGGTATTCCTCCTATGCCA -3'
   OnionR2:  5'- ACCAAGGGAGGACGATGAGTTAGA -3'