840:153g:Projects/project23

From OpenWetWare
Jump to: navigation, search

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext">09/20/2012,09/27/2012,10/04/2012,10/11/2012,10/18/2012,10/25/2012,10/26/2012,11/01/2012,11/02/2012,11/08/2012,11/09/2012,11/15/2012,11/29/2012</div><div style="display:none;" id="page">840:153g:Projects/project23</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages Help.png

Team Members

  • Valerie Wisco
  • Casey Durnan

Cloning of the Outer Membrane f-type Cytochrome(OmcF) gene

  • Background Information

One of the best and most studied organisms on the production of bioelectricity would be the anaerobic bacteria of Geobacter sulfurreducens.This microbe is able to produce high current densities in microbial fuel cells and there has been broad studies on extracellular electron transfer to Fe(III) oxide in this organism which might provide insights into extracellular electron transfer to electrodes. Through some research Geobacter sulfurreducens has been shown to have several outer membrane cytochromes that may be involved in the electricity production. One particular gene, the outer membrane f-type cytochrome or OmcF gene has shown its involvement in the electricity production process through a study done by researchers at the University of Massachusetts. In this study they worked with OmcF deficient microbes and found that there was a significant decrease in the reduction of Fe(III) and a decrease in current production in this microbe. By the tests done by the researches, OmcF is is shown to be required for proper levels of transcription of other genes that are highly regulated when this microbe grows on the surface of an anode of a microbial fuel cell as compared to the growth on a soluble electron acceptor. Thus showing that the OmcF plays a role in regulating proteins that help aid in the electron transport across the cell membrane. This involvement is why we have chosen to clone this particular gene.


  • OmcF Gene Information:

Accession Number:AAR35805.1
315 base pairs;no introns
The culture was received from researchers at the University of Massachusetts, compliments of Joy Ward, Lab Manager
It will be cultured in NBAF media and grown until appropriate extraction takes place.


  • General Procedure:

1.)Grow Geobacter sulfurreducens on NBAF media
2.)DNA extraction
3.)PCR amplification
4.)Quality check/ purify DNA by electophoresis
5.)Digestion of source DNA and promoter
6.)Ligation
7.)Digestion/Ligation of new part and plasmid
8.)Transformation into E. Coli host
9.)Antibiotic selection- Kanomycin resistent vector
10.)Verify through SDS-PAGE


  • Primer Selection

23F_omcfsf - 5’= GAATTCGCGGCCGCTTCTAGAGATGAGAGGGCTTGCCCCGGT=3’
23R_omcfsr - 5’= TACTAGTAGCGGCCGCTGCAGTCATGGGAAGCTCGCCACGA=3'
23F_omcfmf - 5’= GGCCCTGGCGGCCGGTTGCAGCGGCGGGTCCGGCGC=3’
23R_omcfmr - 5’= GCGCCGGACCCGCCGCTGCAACCGGCCGCCAGGGCC=3’


  • Promoter Selection

pBad/araC which is induced through the use of L-arabinose, and inhibited by araC [1]

  • Vector Selection:
psB2k3 [2]


  • Powerpoint Presentation:

File:Cloning the omcF gene-1.ppt

  • Final Presentation::

File:Recombinant DNA- Final Presentation 2b.pptx


References

Kim, B., Postier, B., DiDonato, R., Chaudhuri, S., Nevin, K., & Lovely D. (2008). Insights into genes involved in electricity generation in geobacter sulfurreducens via whole genome microarray analysis of the omcf-de!cient mutant. Bioelectrochemistry, Retrieved from http://www.geobacter.org/publication-files/18538641.pdf [3]

http://www.ncbi.nlm.nih.gov/nuccore/NC_002939.5?report=genbank&from=2667181&to=2667495&strand=true----

http://www.geobacter.org/about




  • Please also make yourself familiar with uploading pictures and *.ppt files

Important Results and Milestones

  • keep track of your most important results and refer to the corresponding page in your notebook
  • upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).
Recent changes

25 September 2017

     06:18 

(Upload log). .

[Anshul Krishnan‎ (2×)]

     

06:18

. . Anshul Krishnan (talk | contribs) uploaded File:BME100TempVTrials.png

     

06:10

. . Anshul Krishnan (talk | contribs) uploaded File:BME100L3Temp.png

24 September 2017

N    22:33  MediaWiki:Tagline‎ (diff | hist) . . (+16). . Yardena Cohen (talk | contribs) (less parsing)
N    22:32  MediaWiki:Pagetitle-view-mainpage‎ (diff | hist) . . (+11). . Yardena Cohen (talk | contribs) (less parsing)
N    22:32  MediaWiki:Opensearch-desc‎ (diff | hist) . . (+16). . Yardena Cohen (talk | contribs) (english-only?)
N    21:21  MediaWiki:Pagetitle‎ (diff | hist) . . (+16). . Yardena Cohen (talk | contribs) (idk if this will help or hurt)
N    21:18  MediaWiki:Aboutsite‎ (diff | hist) . . (+17). . Yardena Cohen (talk | contribs) (one less thing to parse)

     20:08 

(Upload log). .

[Anna Hoge‎ (2×)]

     

20:08

. . Anna Hoge (talk | contribs) uploaded File:AHgraph4.png

     

18:52

. . Anna Hoge (talk | contribs) uploaded File:AHgraph3.png

23 September 2017

     17:17  MediaWiki:Contactpage-pagetext‎ (diff | hist) . . (+36). . Yardena Cohen (talk | contribs) (don't ask me science questions plz)

     17:05 

(Deletion log). .

[Yardena Cohen‎ (6×)]

     

17:05

. . Yardena Cohen (talk | contribs) deleted page User talk:Deepak P Patil(Automatically deleted when merging users)

     

17:05

. . Yardena Cohen (talk | contribs) deleted page User:Deepak P Patil(Automatically deleted when merging users)

     

16:39

. . Yardena Cohen (talk | contribs) deleted page User talk:Chun H Hsieh(Automatically deleted when merging users)

     

16:39

. . Yardena Cohen (talk | contribs) deleted page User:Chun H Hsieh(Automatically deleted when merging users)

     

15:39

. . Yardena Cohen (talk | contribs) deleted page User talk:Satu Strandman(Automatically deleted when merging users)

     

15:39

. . Yardena Cohen (talk | contribs) deleted page User:Satu Strandman(Automatically deleted when merging users)

     17:05 

(User merge log). .

[Yardena Cohen‎ (6×)]

     

17:05

. . Yardena Cohen (talk | contribs) Deleted user: Deepak P Patil (8544) ‎

     

17:05

. . Yardena Cohen (talk | contribs) User Deepak P Patil (8544) merged to Anonymous (0) ‎

     

16:39

. . Yardena Cohen (talk | contribs) Deleted user: Chun H Hsieh (13046) ‎

     

16:39

. . Yardena Cohen (talk | contribs) User Chun H Hsieh (13046) merged to Anonymous (0) ‎

     

15:39

. . Yardena Cohen (talk | contribs) Deleted user: Satu Strandman (13640) ‎

     

15:39

. . Yardena Cohen (talk | contribs) User Satu Strandman (13640) merged to Anonymous (0) ‎

N    14:04 

MediaWiki:Contactpage-label‎‎ (2 changes | history) . . (+7). . [Yardena Cohen‎ (2×)]

     

14:04

(cur | prev) . . (-4). . Yardena Cohen (talk | contribs) (one word so it doesn't get wrapped)

N    

13:59

(cur | prev) . . (+11). . Yardena Cohen (talk | contribs) (label text for footer?)

     14:02 

New server‎‎ (2 changes | history) . . (-137). . [Yardena Cohen‎ (2×)]

     

14:02

(cur | prev) . . (+10). . Yardena Cohen (talk | contribs) (contact form)

     

11:34

(cur | prev) . . (-147). . Yardena Cohen (talk | contribs) (it happened)

N    14:01 

MediaWiki:Contactpage-url‎‎ (4 changes | history) . . (+21). . [Yardena Cohen‎ (4×)]

     

14:01

(cur | prev) . . (-23). . Yardena Cohen (talk | contribs) (relative again)

     

14:01

(cur | prev) . . (-10). . Yardena Cohen (talk | contribs) (actual url)

     

13:59

(cur | prev) . . (+23). . Yardena Cohen (talk | contribs) (full url?)

N    

13:57

(cur | prev) . . (+31). . Yardena Cohen (talk | contribs) (relative link)

     13:52 

(User rights log). .

[Yardena Cohen‎ (2×)]

     

13:52

. . Yardena Cohen (talk | contribs) changed group membership for Oww Op from bureaucrat and administrator to staff ‎

     

13:52

. . Yardena Cohen (talk | contribs) changed group membership for Oww Op from (none) to administrator and bureaucrat ‎

     13:47 (User creation log) . . User account Oww Op (talk | contribs) was created by Yardena Cohen (talk | contribs) and password was sent by email ‎
     11:34 (Patrol log) . . Yardena Cohen (talk | contribs) automatically marked revision 996201 of page New server patrolled ‎
     11:33  BIOL398-04/S15:Class Assignments by Week‎ (diff | hist) . . (-3). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Tessa A. Morris Class Assignments by Week to Tessa Morris Class Assignments by Week in a maintenance job.)
     11:33  Paris Bettencourt 2012/Notebook/modularity group/day by day/2012/07‎ (diff | hist) . . (+1). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from IGEM:Paris Bettencourt 2012/Notebook/modularity group/day by day//2012/07 to IGEM:Paris Bettencourt 2012/Notebooks/modularity group/day by day//2012/07 in a maintenance job.)
     11:33  Paris Bettencourt 2012/Notebook/modularity group/day by day/2012/07/03‎ (diff | hist) . . (+1). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from IGEM:Paris Bettencourt 2012/Notebook/modularity group/day by day//2012/07/03 to IGEM:Paris Bettencourt 2012/Notebooks/modularity group/day by day//2012/07/03 in a maintenance job.)
     11:33  BIOMOD/2012/TeamSendaiA/Methods‎ (diff | hist) . . (-1). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from BIOMOD/2012/TeamSendaiA/Methodsa to Biomod/2012/TeamSendaiA/Methods in a maintenance job.)
     11:33  Biomod/2012/TU Dresden/Nanosaurs/Project/Sponsor‎ (diff | hist) . . (+1). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Biomod/2012/TU Dresden/Nanosaurs/Sponsor to Biomod/2012/TU Dresden/Nanosaurs/Sponsors in a maintenance job.)
     11:33  User:Etienne Robillard/Notebook/Phenylmethylamine‎ (diff | hist) . . (-6). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from User:Etienne Robillard/Notebook/Phenylmethanamine to User:Etienne Robillard/Notebook/Benzylamine in a maintenance job.)
     11:33  Farre Lab:Teaching & Research Program‎ (diff | hist) . . (-18). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Farre Lab:Teaching&Research Program to Farre Lab:NSF T&R in a maintenance job.)
     11:33  Farre Lab:Teaching&Research Program‎ (diff | hist) . . (-24). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Farre Lab:Farre-Teaching&Research Program to Farre Lab:NSF T&R in a maintenance job.)
     11:33  Farre Lab:Farre-Teaching&Research Program‎ (diff | hist) . . (-21). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Farre Lab:NSFTeaching&Research Program to Farre Lab:NSF T&R in a maintenance job.)
     11:33  User:Etienne Robillard/Notebook/Chemtrails911 notebook/Agent Ecoli:PhotoReceptorComponent‎ (diff | hist) . . (-26). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from User:Etienne Robillard/Notebook/Agent Ecoli:PhotoReceptorComponent to User:Etienne Robillard/Notebook/Agent BZ in a maintenance job.)
     11:33  BIOX‎ (diff | hist) . . (+9). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Liu BioX to Template:Liu BioX in a maintenance job.)
     11:33  User:Kodipad Shafahed‎ (diff | hist) . . (+5). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from King jazz to User:King jazz in a maintenance job.)
     11:33  User talk:Kodipad Shafahed‎ (diff | hist) . . (+5). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Talk:King jazz to User talk:King jazz in a maintenance job.)
     11:33  User talk:Sen Liu‎ (diff | hist) . . (+3). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Talk:LiuGroup CTGU to Talk:LiuGroup of CTGU in a maintenance job.)
     11:33  User:Eung-Sam Kim‎ (diff | hist) . . (+1). . Redirect fixer (talk | contribs) (Automatically fixing double redirect from Nanobilogy Lab to Nanobiology Lab in a maintenance job.)