840:153g:Projects/project23

From OpenWetWare
Jump to: navigation, search

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext">09/20/2012,09/27/2012,10/04/2012,10/11/2012,10/18/2012,10/25/2012,10/26/2012,11/01/2012,11/02/2012,11/08/2012,11/09/2012,11/15/2012,11/29/2012</div><div style="display:none;" id="page">840:153g:Projects/project23</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages Help.png

Team Members

  • Valerie Wisco
  • Casey Durnan

Cloning of the Outer Membrane f-type Cytochrome(OmcF) gene

  • Background Information

One of the best and most studied organisms on the production of bioelectricity would be the anaerobic bacteria of Geobacter sulfurreducens.This microbe is able to produce high current densities in microbial fuel cells and there has been broad studies on extracellular electron transfer to Fe(III) oxide in this organism which might provide insights into extracellular electron transfer to electrodes. Through some research Geobacter sulfurreducens has been shown to have several outer membrane cytochromes that may be involved in the electricity production. One particular gene, the outer membrane f-type cytochrome or OmcF gene has shown its involvement in the electricity production process through a study done by researchers at the University of Massachusetts. In this study they worked with OmcF deficient microbes and found that there was a significant decrease in the reduction of Fe(III) and a decrease in current production in this microbe. By the tests done by the researches, OmcF is is shown to be required for proper levels of transcription of other genes that are highly regulated when this microbe grows on the surface of an anode of a microbial fuel cell as compared to the growth on a soluble electron acceptor. Thus showing that the OmcF plays a role in regulating proteins that help aid in the electron transport across the cell membrane. This involvement is why we have chosen to clone this particular gene.


  • OmcF Gene Information:

Accession Number:AAR35805.1
315 base pairs;no introns
The culture was received from researchers at the University of Massachusetts, compliments of Joy Ward, Lab Manager
It will be cultured in NBAF media and grown until appropriate extraction takes place.


  • General Procedure:

1.)Grow Geobacter sulfurreducens on NBAF media
2.)DNA extraction
3.)PCR amplification
4.)Quality check/ purify DNA by electophoresis
5.)Digestion of source DNA and promoter
6.)Ligation
7.)Digestion/Ligation of new part and plasmid
8.)Transformation into E. Coli host
9.)Antibiotic selection- Kanomycin resistent vector
10.)Verify through SDS-PAGE


  • Primer Selection

23F_omcfsf - 5’= GAATTCGCGGCCGCTTCTAGAGATGAGAGGGCTTGCCCCGGT=3’
23R_omcfsr - 5’= TACTAGTAGCGGCCGCTGCAGTCATGGGAAGCTCGCCACGA=3'
23F_omcfmf - 5’= GGCCCTGGCGGCCGGTTGCAGCGGCGGGTCCGGCGC=3’
23R_omcfmr - 5’= GCGCCGGACCCGCCGCTGCAACCGGCCGCCAGGGCC=3’


  • Promoter Selection

pBad/araC which is induced through the use of L-arabinose, and inhibited by araC [1]

  • Vector Selection:
psB2k3 [2]


  • Powerpoint Presentation:

File:Cloning the omcF gene-1.ppt

  • Final Presentation::

File:Recombinant DNA- Final Presentation 2b.pptx


References

Kim, B., Postier, B., DiDonato, R., Chaudhuri, S., Nevin, K., & Lovely D. (2008). Insights into genes involved in electricity generation in geobacter sulfurreducens via whole genome microarray analysis of the omcf-de!cient mutant. Bioelectrochemistry, Retrieved from http://www.geobacter.org/publication-files/18538641.pdf [3]

http://www.ncbi.nlm.nih.gov/nuccore/NC_002939.5?report=genbank&from=2667181&to=2667495&strand=true----

http://www.geobacter.org/about




  • Please also make yourself familiar with uploading pictures and *.ppt files

Important Results and Milestones

  • keep track of your most important results and refer to the corresponding page in your notebook
  • upload important pictures (don't forget to label them! Powerpoint is very convenient). Remember: these will become quite handy later in your summary report or final presentation. If you do label and upload the pictures as soon as you got them, your summary report can be written much more effortlessly (do you usually procrastinate? This is chance to do some work before hand that frees you up for finals week).
Recent changes

25 September 2017

     21:19 

BME100 f2017:Group12 W0800 L3‎‎ (12 changes | history) . . (+3,361). . [Priscilla Y. Han‎ (12×)]

     

21:19

(cur | prev) . . (+25). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

21:15

(cur | prev) . . (+70). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

21:11

(cur | prev) . . (-3). . Priscilla Y. Han (talk | contribs) (Experimental Design of Device)

     

21:10

(cur | prev) . . (-12). . Priscilla Y. Han (talk | contribs) (Experimental Design of Device)

     

21:10

(cur | prev) . . (+15). . Priscilla Y. Han (talk | contribs) (Experimental Design of Device)

     

21:09

(cur | prev) . . (+3,181). . Priscilla Y. Han (talk | contribs) (Experimental Design of Device)

     

21:05

(cur | prev) . . (+5). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

21:03

(cur | prev) . . (+25). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

21:01

(cur | prev) . . (+2). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

20:58

(cur | prev) . . (+29). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

20:57

(cur | prev) . . (-3). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     

20:55

(cur | prev) . . (+27). . Priscilla Y. Han (talk | contribs) (Descriptive Stats and Graph)

     21:19 

(Upload log). .

[Ana C. Carr‎ (4×); Priscilla Y. Han‎ (7×)]

     

21:19

. . Priscilla Y. Han (talk | contribs) uploaded File:Pulsingbargraph12.png

     

21:18

. . Priscilla Y. Han (talk | contribs) uploaded File:Mypear sonheart12.png

     

21:18

. . Priscilla Y. Han (talk | contribs) uploaded File:Heartratespree12.png

     

21:04

. . Priscilla Y. Han (talk | contribs) uploaded File:Scrnshotspree12.png

     

20:59

. . Priscilla Y. Han (talk | contribs) uploaded File:2columnbarsspree.png

     

20:56

. . Priscilla Y. Han (talk | contribs) uploaded a new version of File:Mypear sonr.png

     

20:56

. . Priscilla Y. Han (talk | contribs) uploaded File:Mypear sonr.png

     

18:36

. . Ana C. Carr (talk | contribs) uploaded a new version of File:IMG 5562.jpg(In action)

     

18:36

. . Ana C. Carr (talk | contribs) uploaded a new version of File:IMG 5562.jpg(In action)

     

18:36

. . Ana C. Carr (talk | contribs) uploaded a new version of File:IMG 5562.jpg(In action)

     

18:36

. . Ana C. Carr (talk | contribs) uploaded a new version of File:IMG 5562.jpg(In action)

     20:33 

BME100 f2017:Group8 W1030 L3‎‎ (9 changes | history) . . (+501). . [Jennifer L. Brodsky‎ (9×)]

     

20:33

(cur | prev) . . (+5). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:32

(cur | prev) . . (+112). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:29

(cur | prev) . . (0). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:28

(cur | prev) . . (+13). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:28

(cur | prev) . . (-1). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:26

(cur | prev) . . (+1). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:26

(cur | prev) . . (+177). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:25

(cur | prev) . . (+7). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

     

20:24

(cur | prev) . . (+187). . Jennifer L. Brodsky (talk | contribs) (Experimental Design of Own Device)

N    20:17  BME100 f2017:Group10 W0800 L3‎ (diff | hist) . . (+767). . Whitney Hirano (talk | contribs) (Created page with "5. The mean value of heart rate calculated from the pulse ox was 98.3673 beats/min with a standard deviation of 22.2273, while the mean value of heart rate calculated from the...")
     19:56  BME100 f2017:Group9 W0800 L3‎ (diff | hist) . . (+3). . Irene Zhang (talk | contribs) (LAB 3 WRITE-UP)

     19:52 

BME100 f2017:Projects1‎‎ (3 changes | history) . . (+19). . [Yar‎; Karmella Haynes‎ (2×)]

     

19:52

(cur | prev) . . (0). . Yar (talk | contribs) (small change to force cache purge)

     

19:37

(cur | prev) . . (+21). . Karmella Haynes (talk | contribs)

     

19:11

(cur | prev) . . (-2). . Karmella Haynes (talk | contribs) (Lab 1: “Needs Identification”)

     19:19  CONJ606:Schedule‎ (diff | hist) . . (+23). . Maureen E. Hoatlin (talk | contribs) (Week-by-Week Schedule Summary)

     19:06 

BME100 f2017‎‎ (2 changes | history) . . (+1). . [Karmella Haynes‎ (2×)]

     

19:06

(cur | prev) . . (-8). . Karmella Haynes (talk | contribs)

     

19:06

(cur | prev) . . (+9). . Karmella Haynes (talk | contribs)

     17:38  User:Oww Bot‎ (diff | hist) . . (-956). . Yar (talk | contribs) (it me)

     17:36 

(User rights log). .

[Yar‎ (2×)]

     

17:36

. . Yar (talk | contribs) changed group membership for Oww Bot from bot and administrator to bot ‎

     

17:33

. . Yar (talk | contribs) changed group membership for Yeem from administrator to (none) ‎

     17:35  User:Yar‎ (diff | hist) . . (+26). . Yar (talk | contribs) (my name)

     17:34 

(Move log). .

[Yar‎ (5×)]

     

17:34

. . Yar (talk | contribs) moved page User talk:Yardena Cohen to User talk:Yar(Automatically moved page while renaming the user "Yardena Cohen" to "Yar")

     

17:34

. . Yar (talk | contribs) moved page User:Yardena Cohen/Notebook/attempt/Entry Base to User:Yar/Notebook/attempt/Entry Base(Automatically moved page while renaming the user "Yardena Cohen" to "Yar")

     

17:34

. . Yar (talk | contribs) moved page User:Yardena Cohen/Notebook/attempt to User:Yar/Notebook/attempt(Automatically moved page while renaming the user "Yardena Cohen" to "Yar")

     

17:34

. . Yar (talk | contribs) moved page User:Yardena Cohen/Notebook to User:Yar/Notebook(Automatically moved page while renaming the user "Yardena Cohen" to "Yar")

     

17:34

. . Yar (talk | contribs) moved page User:Yardena Cohen to User:Yar(Automatically moved page while renaming the user "Yardena Cohen" to "Yar")

     17:34 (User rename log) . . Yar (talk | contribs) renamed user Yardena Cohen (108 edits) to Yar(shorter)