Van Oudenaarden Lab:C30A5.7

From OpenWetWare

Jump to: navigation, search

Progress:

Probes designed: (3-04-2010 - Ni Ji)

Probes coupled:

Probes purified:

Probes tested:

Dyes available:


>C30A5.7b (spliced coding sequence - 1404) *PARTIALLY confirmed by cDNA

ATGGAGAAGG CACATCGATT CCGTTTGCCT TTTTGCTCCT TCTTTCCCGT CCCTCTCCTT GTGTCGGTTT TAATATTTCA TCACTCCGCT CCATTTTTAA TTCAACTCTT TTTTCCTTCC CCCCTCTTCA ACCCCCTTCT CCGCCCTTCC AAAATCAGTA GAGGTTCTGA AAATGGGGCG TGCACTAGCC ACAGTACCCT CCAACGGACC AGAAAAATCA TCCAATGGGA GCTGCCTAAA AGGGGTGGAG ACCAAGACAT AGGGGACCCC CGACCCTTCC GTATACATCT GTCTCCTCCC AGCTTCAAGG TCCCCCTCTT TTCCACGGAC ATGCAGAACA CCGCACCCGT ACCGACGACG ACAACCGCTT CAAAAATGCA ACCTTTCAAC AACAGTTTAT TTGGATCATT CGATGACCCA ATTCTCAATG CAAGAGCTGC ACAAGTTGCC CTCGCTGATA TTGATGTTAA AAATGTGCCG CAGTTGACAA ATCCACTTAT GAGACCACAT GATATGTTCA GCTATAGCAA CTACTTTTCG GGAATCCACG ACACATCCGC CGCCACAAAC ATCTACCAAG GACTCCCAAG CTCTTCAGAA CCATTCGATG CATCTGTAGT TGTGCCAACA TCCTCAGATG ATCAAATGAC ACCCTTACAA CAAGTAATGG CAATGCAACA ATCATATGGA GCACCTCCAC CATTTCAATA CAATATGACT CATCCATTTT CAACAACATC CATTGCCAGT TCTAATAATC TTGCTCGTTA CCCAATTGCC CCGCCAACTT CAGATATGGA CACTGATCCG AGACAATTGG AGACGTTTGC AGAGCATTTC AAGCAGAGAA GAATAAAATT AGGAGTCACA CAGGCGGACG TTGGAAAAGC ACTTGCTCAT CTGAAAATGC CTGGTGTCGG ATCATTATCC CAGTCCACGA TCTGCCGCTT CGAATCTCTC ACCCTTTCCC ATAACAACAT GGTCGCACTG AAACCAATTC TACATTCCTG GCTGGAGAAA GCTGAAGAGG CTATGAAACA AAAAGATACA ATTGGAGATA TCAATGGAAT TTTGCCAAAT ACTGATAAGA AACGGAAGAG AACTAGTATT GCTGCTCCTG AGAAAAGAGA ACTAGAACAG TTTTTCAAAC AACAACCAAG ACCATCTGGA GAACGAATTG CCTCAATTGC CGATCGATTG GATTTGAAGA AAAATGTTGT TCGCGTCTGG TTTTGCAATC AACGGCAGAA ACAGAAAAGA GATTTCCGTT CCCAATTCCG TGCAAGAAGT GCAGCAGCAG TAATGGGTCC ACGTGTGATG CCAGTTTTAA ATGGAAATAA TTCAAATAAT AATCTGAAAC AGGGTCAGAC AACATACAAT GGGCTACCTG GATTCTTTGA TTAG


Name of probe set: unc-86 Probes designed on Thu, 04 Mar 10 14:06:29 -0700 48 probes designed for target of length 1404

Probe (5'->3'), Probe name, Probe number, Probe position, Percent GC

aatcgatgtgccttctccat, unc-86_1, 1, 1, 45 gaaggagcaaaaaggcaaac, unc-86_2, 2, 23, 45 taaaaccgacacaaggagag, unc-86_3, 3, 53, 45 atggagcggagtgatgaaat, unc-86_4, 4, 75, 45 ggggaaggaaaaaagagttg, unc-86_5, 5, 103, 45 attttggaagggcggagaag, unc-86_6, 6, 136, 50 cccattttcagaacctctac, unc-86_7, 7, 158, 45 atttttctggtccgttggag, unc-86_8, 8, 199, 45 tttaggcagctcccattgga, unc-86_9, 9, 221, 50 acagatgtatacggaagggt, unc-86_10, 10, 273, 45 ttctgcatgtccgtggaaaa, unc-86_11, 11, 319, 45 tttttgaagcggttgtcgtc, unc-86_12, 12, 357, 45 gggtcatcgaatgatccaaa, unc-86_13, 13, 400, 45 tgcagctcttgcattgagaa, unc-86_14, 14, 422, 45 atcaatatcagcgagggcaa, unc-86_15, 15, 446, 45 gtcaactgcggcacattttt, unc-86_16, 16, 469, 45 catgtggtctcataagtgga, unc-86_17, 17, 492, 45 gattcccgaaaagtagttgc, unc-86_18, 18, 527, 45 tccttggtagatgtttgtgg, unc-86_19, 19, 563, 45 aatggttctgaagagcttgg, unc-86_20, 20, 586, 45 tggcacaactacagatgcat, unc-86_21, 21, 608, 45 gggtgtcatttgatcatctg, unc-86_22, 22, 635, 45 gtgctccatatgattgttgc, unc-86_23, 23, 675, 45 ctggcaatggatgttgttga, unc-86_24, 24, 730, 45 caattgggtaacgagcaaga, unc-86_25, 25, 759, 45 tgtccatatctgaagttggc, unc-86_26, 26, 783, 45 aaacgtctccaattgtctcg, unc-86_27, 27, 809, 45 cttctctgcttgaaatgctc, unc-86_28, 28, 832, 45 gcctgtgtgactcctaattt, unc-86_29, 29, 856, 45 agcaagtgcttttccaacgt, unc-86_30, 30, 878, 45 cgacaccaggcattttcaga, unc-86_31, 31, 900, 50 atcgtggactgggataatga, unc-86_32, 32, 922, 45 aaagggtgagagattcgaag, unc-86_33, 33, 948, 45 agtgcgaccatgttgttatg, unc-86_34, 34, 970, 45 gccaggaatgtagaattggt, unc-86_35, 35, 993, 45 atagcctcttcagctttctc, unc-86_36, 36, 1015, 45 ctcttccgtttcttatcagt, unc-86_37, 37, 1081, 40 tctcaggagcagcaatacta, unc-86_38, 38, 1104, 45 ggtcttggttgttgtttgaa, unc-86_39, 39, 1144, 40 ttgaggcaattcgttctcca, unc-86_40, 40, 1167, 45 ttcaaatccaatcgatcggc, unc-86_41, 41, 1189, 45 ccagacgcgaacaacatttt, unc-86_42, 42, 1211, 45 gtttctgccgttgattgcaa, unc-86_43, 43, 1233, 45 gaattgggaacggaaatctc, unc-86_44, 44, 1259, 45 ttactgctgctgcacttctt, unc-86_45, 45, 1284, 45 taaaactggcatcacacgtg, unc-86_46, 46, 1310, 45 gtctgaccctgtttcagatt, unc-86_47, 47, 1351, 45 atccaggtagcccattgtat, unc-86_48, 48, 1374, 45

Personal tools