Van Oudenaarden Lab:C17C3.8

From OpenWetWare

Jump to: navigation, search

Progress:

Probes designed: (03-04-2010 - Christoph Engert)

Probes coupled:

Probes purified:

Probes tested:

Dyes available:


>C17C3.8 (spliced + UTR - 755) ATGTCTTCCT CTCCAACTTC GTCATCATCT GGGTCCCCTT CTTCACATGG ACATCGATCT GAAACAGAAA AACAAAGAAG AGATGATACT AATGATCTGT TGAATGAATT CAAGAAAATC GTTCAAAAAT CGGAATCTGA AAAACTTTCA AAAGAAGAGG TTCTATTTCG TATTGTGAAA TTGTTATCTG GTATTCAACT TCATCACGAA TCGTTTTCAA CATCGCCTGG ACCAATTAGA AGTATTAAAA AGATTAAAAG CGATCGGGAA CAAGTTCGCC GAAATAAGAG AGTTGCCGCG TACAGAGAGC TCAGAAAATT TATTGCATTG AATAATTTGA GTAGCTCAGA AGAAATAGAC AAAATGGAGA ATTTGAAGGT TCTAGAAATC ATCTTTGAAG TGATTCGTGG AAAGTCGATC ACATGTACAG TACCTTGCCT ACCATTTCCA ATACTTCCTT TTCTCCCAGT ATTCCCAGTT TATTCGCCAT TAGTTTTCAA TTCATACAAT CAATTTTCAC TTTATCCTCC TCACATGCCT ACAGTTCAGA TTCCTATTGT CCCAAGTTCC AGCTTCGAAA TTGACGCTCT GGAAATAGAA GAAAATGAGA AAGATATCGA TATTGTTGGC TGAagagatt cagctgaaaa tcgtattggt ctccaatttt tttcaacagt tttcaacatt atttagacat cttttgcatc ccgattcatt gaaaattaat aaatttaaaa aagtaacatc aagat


Name of probe set: hlh-26 Probes designed on Wed, 03 Mar 10 23:47:03 -0700 30 probes designed for target of length 755

Probe (5'->3'), Probe name, Probe number, Probe position, Percent GC

gaagttggagaggaagacat, hlh-26_1, 1, 1, 45 aagaaggggacccagatgat, hlh-26_2, 2, 24, 50 gtttcagatcgatgtccatg, hlh-26_3, 3, 46, 45 cagatcattagtatcatctc, hlh-26_4, 4, 80, 35 cgattttcttgaattcattc, hlh-26_5, 5, 102, 30 gaaagtttttcagattccga, hlh-26_6, 6, 130, 35 acgaaatagaacctcttctt, hlh-26_7, 7, 152, 35 gaagttgaataccagataac, hlh-26_8, 8, 183, 35 gatgttgaaaacgattcgtg, hlh-26_9, 9, 205, 40 aatacttctaattggtccag, hlh-26_10, 10, 227, 35 gttcccgatcgcttttaatc, hlh-26_11, 11, 252, 45 actctcttatttcggcgaac, hlh-26_12, 12, 274, 45 ttttctgagctctctgtacg, hlh-26_13, 13, 299, 45 ctgagctactcaaattattc, hlh-26_14, 14, 330, 35 ttctccattttgtctatttc, hlh-26_15, 15, 352, 30 gatgatttctagaaccttca, hlh-26_16, 16, 374, 35 gactttccacgaatcacttc, hlh-26_17, 17, 397, 45 gcaaggtactgtacatgtga, hlh-26_18, 18, 419, 45 aaggaagtattggaaatggt, hlh-26_19, 19, 441, 35 taaactgggaatactgggag, hlh-26_20, 20, 463, 45 tgaattgaaaactaatggcg, hlh-26_21, 21, 485, 35 gtgaggaggataaagtgaaa, hlh-26_22, 22, 515, 40 taggaatctgaactgtaggc, hlh-26_23, 23, 537, 45 ttcgaagctggaacttggga, hlh-26_24, 24, 560, 50 cttctatttccagagcgtca, hlh-26_25, 25, 582, 45 cagccaacaatatcgatatc, hlh-26_26, 26, 613, 40 acgattttcagctgaatctc, hlh-26_27, 27, 635, 40 gttgaaaaaaattggagacc, hlh-26_28, 28, 658, 35 gatgtctaaataatgttgaa, hlh-26_29, 29, 682, 25 ttcaatgaatcgggatgcaa, hlh-26_30, 30, 704, 40


Input sequence with probe locations:


atgtcttcctctccaacttcgtcatcatctgggtccccttcttcacatggacatcgatctgaaacagaaa tacagaaggagaggttgaag tagtagacccaggggaagaa gtacctgtagctagactttg Probe # 1, 45% GC Probe # 2, 50% GC Probe # 3, 45% GC

aacaaagaagagatgatactaatgatctgttgaatgaattcaagaaaatcgttcaaaaatcggaatctga

        ctctactatgattactagac  cttacttaagttcttttagc        agccttagact
        Probe # 4, 35% GC     Probe # 5, 30% GC           Probe # 6, 

aaaactttcaaaagaagaggttctatttcgtattgtgaaattgttatctggtattcaacttcatcacgaa ttttgaaag ttcttctccaagataaagca caatagaccataagttgaag gtgctt 35% GC Probe # 7, 35% GC Probe # 8, 35% GC Probe

tcgttttcaacatcgcctggaccaattagaagtattaaaaagattaaaagcgatcgggaacaagttcgcc agcaaaagttgtag gacctggttaatcttcataa ctaattttcgctagcccttg caagcgg

  1. 9, 40% GC Probe # 10, 35% GC Probe # 11, 45% GC Probe #

gaaataagagagttgccgcgtacagagagctcagaaaatttattgcattgaataatttgagtagctcaga ctttattctctca gcatgtctctcgagtctttt cttattaaactcatcgagtc

12, 45% GC       Probe # 13, 45% GC             Probe # 14, 35% GC   

agaaatagacaaaatggagaatttgaaggttctagaaatcatctttgaagtgattcgtggaaagtcgatc

ctttatctgttttacctctt  acttccaagatctttagtag   cttcactaagcacctttcag  ag
Probe # 15, 30% GC    Probe # 16, 35% GC     Probe # 17, 45% GC    Pr

acatgtacagtaccttgcctaccatttccaatacttccttttctcccagtattcccagtttattcgccat tgtacatgtcatggaacg tggtaaaggttatgaaggaa gagggtcataagggtcaaat gcggta obe # 18, 45% GC Probe # 19, 35% GC Probe # 20, 45% GC Probe

tagttttcaattcatacaatcaattttcactttatcctcctcacatgcctacagttcagattcctattgt atcaaaagttaagt aaagtgaaataggaggagtg cggatgtcaagtctaaggat a

  1. 21, 35% GC Probe # 22, 40% GC Probe # 23, 45% GC P

cccaagttccagcttcgaaattgacgctctggaaatagaagaaaatgagaaagatatcgatattgttggc gggttcaaggtcgaagctt actgcgagacctttatcttc ctatagctataacaaccg robe # 24, 50% GC Probe # 25, 45% GC Probe # 26, 40% GC

tgaagagattcagctgaaaatcgtattggtctccaatttttttcaacagttttcaacattatttagacat ac ctctaagtcgacttttagca ccagaggttaaaaaaagttg aagttgtaataaatctgta

   Probe # 27, 40% GC     Probe # 28, 35% GC      Probe # 29, 25% GC 

cttttgcatcccgattcattgaaaattaataaatttaaaaaagtaacatcaagat g aacgtagggctaagtaactt

  Probe # 30, 40% GC
Personal tools