Van Oudenaarden Lab:C17C3.7

From OpenWetWare

Jump to: navigation, search

Progress:

Probes designed: (03-04-2010 - Christoph Engert)

Probes coupled:

Probes purified:

Probes tested:

Dyes available:


>C17C3.7 (spliced + UTR - 807) ATGCCAAAAG TTATTCAGTC TTCAATGAGC GATTATCGTT CCGTCCCATA CAATCAAACT CCAAAATCAG CTTCTGAACG

GAAAAGAAGA AATATTACAA ACGAGTTGAT TAACGAATGC AAGACGATTG TTCAAAAATC AGAAGAAGAA CATATATCAC AAGAAGTAGT TCTCTTCCGA ATTGTGAAAC TTGTGACTGG AGTTAATCTG GAATCTAATT TCTCATCGAA TGACCTCTCC GAATCTACAA GACGGAAGTT TGATACTGAA TCCGAAAGAA GAAAAGTGAA GACTGAACGT GAAAAGATTC GAAGAAAGAA ACAAGATGAC TGTTATGCTG AATTGAAATT CTTCATTTTG AACAAACAAA TGGGAAGTTA CGAGCAACGA TTAAAACTTG AACGGATCAC AATTCTAGAA ATCATCATTG ATTACATTAA ACACAATTCC GATCTTCTGT ATCCAGAAAC AATTCCCCAA ATACTTCCTC TTTTAGCTGG AAAATCAACT GCTACTTGTG AGAACAAAGA GAATGAAAAG CCAAAAACAC GAATGGAAGT GAAGGATCTC TTCCCAAGAT TGACGTTTCA AGAAGTTCAA GAATCCCCAA CATCTACTTC TCCATTGCTC ACATTTCCAT GTATTCCAAT GATCCCAACT ACTCAGTTCA ATGTCTTGTC AAACTACAAC ACCGTTCCAT CAATATTTTC TGCTCCCCTC CGATTCATTC TTCCATCACT TCAAATCTTA ACACCAGAAA CTAGTGACGA GGAAGAAAAT GAAGAAACCC TCGATATAAT TAACTAG


Name of probe set: hlh-25 Probes designed on Wed, 03 Mar 10 22:55:07 -0700 32 probes designed for target of length 807

Probe (5'->3'), Probe name, Probe number, Probe position, Percent GC

gactgaataacttttggcat, hlh-25_1, 1, 1, 35 ggaacgataatcgctcattg, hlh-25_2, 2, 23, 45 ttggagtttgattgtatggg, hlh-25_3, 3, 45, 40 cttttccgttcagaagctga, hlh-25_4, 4, 67, 45 gcattcgttaatcaactcgt, hlh-25_5, 5, 101, 40 ctgatttttgaacaatcgtc, hlh-25_6, 6, 123, 35 cggaagagaactacttcttg, hlh-25_7, 7, 160, 45 ctccagtcacaagtttcaca, hlh-25_8, 8, 183, 45 gaggtcattcgatgagaaat, hlh-25_9, 9, 218, 40 acttccgtcttgtagattcg, hlh-25_10, 10, 240, 45 cttctttcggattcagtatc, hlh-25_11, 11, 262, 40 ttcacgttcagtcttcactt, hlh-25_12, 12, 284, 40 cttgtttctttcttcgaatc, hlh-25_13, 13, 306, 35 ttcaattcagcataacagtc, hlh-25_14, 14, 328, 35 cttcccatttgtttgttcaa, hlh-25_15, 15, 358, 35 caagttttaatcgttgctcg, hlh-25_16, 16, 381, 40 atttctagaattgtgatccg, hlh-25_17, 17, 403, 35 cagaagatcggaattgtgtt, hlh-25_18, 18, 440, 40 tttggggaattgtttctgga, hlh-25_19, 19, 462, 40 tttccagctaaaagaggaag, hlh-25_20, 20, 484, 40 gttctcacaagtagcagttg, hlh-25_21, 21, 506, 45 ccattcgtgtttttggcttt, hlh-25_22, 22, 537, 40 tcttgggaagagatccttca, hlh-25_23, 23, 560, 45 cttgaacttcttgaaacgtc, hlh-25_24, 24, 582, 40 atggagaagtagatgttggg, hlh-25_25, 25, 606, 45 ggaatacatggaaatgtgag, hlh-25_26, 26, 628, 40 gaactgagtagttgggatca, hlh-25_27, 27, 650, 45 cggtgttgtagtttgacaag, hlh-25_28, 28, 675, 45 ggagcagaaaatattgatgg, hlh-25_29, 29, 697, 40 gtgatggaagaatgaatcgg, hlh-25_30, 30, 720, 45 cgtcactagtttctggtgtt, hlh-25_31, 31, 750, 45 cgagggtttcttcattttct, hlh-25_32, 32, 774, 40


Input sequence with probe locations:


atgccaaaagttattcagtcttcaatgagcgattatcgttccgtcccatacaatcaaactccaaaatcag tacggttttcaataagtcag gttactcgctaatagcaagg gggtatgttagtttgaggtt agtc Probe # 1, 35% GC Probe # 2, 45% GC Probe # 3, 40% GC Prob

cttctgaacggaaaagaagaaatattacaaacgagttgattaacgaatgcaagacgattgttcaaaaatc gaagacttgccttttc tgctcaactaattgcttacg ctgctaacaagtttttag e # 4, 45% GC Probe # 5, 40% GC Probe # 6, 35% GC

agaagaagaacatatatcacaagaagtagttctcttccgaattgtgaaacttgtgactggagttaatctg tc gttcttcatcaagagaaggc acactttgaacactgacctc

                  Probe # 7, 45% GC      Probe # 8, 45% GC           

gaatctaatttctcatcgaatgacctctccgaatctacaagacggaagtttgatactgaatccgaaagaa

      taaagagtagcttactggag  gcttagatgttctgccttca  ctatgacttaggctttctt
      Probe # 9, 40% GC     Probe # 10, 45% GC    Probe # 11, 40% GC 

gaaaagtgaagactgaacgtgaaaagattcgaagaaagaaacaagatgactgttatgctgaattgaaatt c ttcacttctgacttgcactt ctaagcttctttctttgttc ctgacaatacgacttaactt

  Probe # 12, 40% GC    Probe # 13, 35% GC    Probe # 14, 35% GC     

cttcattttgaacaaacaaatgggaagttacgagcaacgattaaaacttgaacggatcacaattctagaa

      aacttgtttgtttacccttc   gctcgttgctaattttgaac  gcctagtgttaagatctt
      Probe # 15, 35% GC     Probe # 16, 40% GC    Probe # 17, 35% GC

atcatcattgattacattaaacacaattccgatcttctgtatccagaaacaattccccaaatacttcctc ta ttgtgttaaggctagaagac aggtctttgttaaggggttt gaaggag

                  Probe # 18, 40% GC    Probe # 19, 40% GC    Probe #

ttttagctggaaaatcaactgctacttgtgagaacaaagagaatgaaaagccaaaaacacgaatggaagt aaaatcgaccttt gttgacgatgaacactcttg tttcggtttttgtgcttacc a

20, 40% GC    Probe # 21, 45% GC             Probe # 22, 40% GC     P

gaaggatctcttcccaagattgacgtttcaagaagttcaagaatccccaacatctacttctccattgctc cttcctagagaagggttct ctgcaaagttcttcaagttc gggttgtagatgaagaggta gag robe # 23, 45% GC Probe # 24, 40% GC Probe # 25, 45% GC Pro

acatttccatgtattccaatgatcccaactactcagttcaatgtcttgtcaaactacaacaccgttccat tgtaaaggtacataagg actagggttgatgagtcaag gaacagtttgatgttgtggc ggta be # 26, 40% GC Probe # 27, 45% GC Probe # 28, 45% GC Prob

caatattttctgctcccctccgattcattcttccatcacttcaaatcttaacaccagaaactagtgacga gttataaaagacgagg ggctaagtaagaaggtagtg ttgtggtctttgatcactgc e # 29, 40% GC Probe # 30, 45% GC Probe # 31, 45% GC

ggaagaaaatgaagaaaccctcgatataattaactag

  tcttttacttctttgggagc              
  Probe # 32, 40% GC
Personal tools