User:Torsten Waldminghaus/Primer

From OpenWetWare

Jump to: navigation, search
  • All primers are in concentrations of 100pmol/μL
}
Name Sequence Characteristics Primer number
GFPrv ctgatttaatctgtatcaggc The following primers are for the mutagenesis of GFP to introduce GATC sites as silent mutation (GFPrv, GFPfw, GFPmut1fw, GFPmut2rv, GFPmut3fw, GFPmut4rv, GFPmut5fw, GFPmut6fw, GFPmut7fw, GFPmut8fw, GFPmut9fw) Tm 55 (salt adjusted)[1] 1
GFPfw CTCTCTACTGTTTCTCCATAC Tm 57 2
GFPmut1fw caaacaaaagaatggGatcaaagctaac 5’-phosph. HPLC Tm 62 [without mutated nucleotide] 3
GFPmut2rv caatgttgtggcgGatCttgaagttag 5’-phosph. HPLC Tm 63 [without mutated nucleotide] 4
GFPmut3fw caactagcagaTcattatcaacaaaatac 5’-phosph. HPLC Tm 63 [without mutated nucleotide] 5
GFPmut4rv gccatcgccGatCggagtattttg 5’-phosph. HPLC Tm 62 [without mutated nucleotide] 6
GFPmut5fw cgaaaagcgtgaTcacatggtcc 5’-phosph. HPLC Tm 64 [without mutated nucleotide] 7
GFPmut6fw ctgctgctgggatCacacatggc 5’-phosph. HPLC Tm 66 [without mutated nucleotide] 8
GFPmut7fw GTTATCCGGACCATATGAAACGGC 5’-phosph. HPLC 9
GFPmut8fw CATTGAAGATGGGTCCGTTCAACTAG 5’-phosph. HPLC 10
GFPmut9fw CCTTTCGAAAGACCCCAACGAAAAG 5’-phosph. HPLC 11
GATC19DNAfw GCCCGCGGATCCGCCCGCC oligo for methylation experiment from A. Humeny et al. 2003 12
GATC19DNArv GGCGGGCGGATCCGCGGGC oligo for methylation experiment from A. Humeny et al. 2003 13
MseIlong AGTGGGATTCCGCATGCTAGT 14
MseIshortnewNo TAACTAGCATGC Not phosphorilated 15
MseIshortnew TAACTAGCATGC 5'modified with phosphate 16
bet-fw GTCGACCCACAGGAACTGAT To distinguish DY330 (with lambda phage) from other E. coli strains use primers for bet as part of the recombination machinery of lambda 17
bet-rev GGCTGACGTTCTGCAGTGTA To distinguish DY330 (with lambda phage) from other E. coli strains use primers for bet as part of the recombination machinery of lambda 18
Cut-test_fw TAATAGGCATGCTAGCAGCTG AGCGTAGCTAGCGATGCAACGAC GGTGATCAGCGTCGATGCAGCCG AAACGATGACTGTCACATAGCTG ATGCTTTGCT 19
Cut_test_rv TAAGCAAAGCATCAGCTATGT GACAGTCATCGTTTCGGCTGCAT CGACGAAGATCACCGTCGTTGCA TCGCTAGCTACGCTCAGCTGCTA GCATGCCTAT 20
Cut-test-meth_fw TAATAGGCATGCTAGCAGCTG AGCGTAGCTAGCGATGCAACGAC GGTGATCAGCGTCGATGCAGCCG AAACGATGACTGTCACATAGCTG ATGCTTTGCT modified at position 49 with N6-methyl-dA 21
Cut_test-meth_rv TAAGCAAAGCATCAGCTATGT GACAGTCATCGTTTCGGCTGCAT CGACGAAGATCACCGTCGTTGCA TCGCTAGCTACGCTCAGCTGCTA GCATGCCTAT modified at position 53 with N6-methyl-dA 22
gatRfw cgctttctcgaacaaaaagg 23
gatRrv atgaatcgagaacggcaatc 24
yoeAfw actgcaaccgcaacttcttc 25
yoeArv cactacctcaacacgctcca 26
ter-check-fw tcgtactggtgatggaacga For checking the insertion of GATC cluster near terC with outside primers 27
ter-check-rv aggattcacgcgataagtgg 28
T7fw GAAATTAATACGACTCACTATAGGG 29
ORIrvT7 CACCGATCATTCACAGTTAATGATCC TTTCCAGGTTGTTGATCTTA AAAGCCGGATCCTTGCCC TATAGTGAGTCGTATTAATTTC 30
ORIfwT7 CAAGGATCCGGCTTTTAAGATCAACA ACCTGGAAAGGATCATTAAC TGTGAATGATCGGTGCCC TATAGTGAGTCGTATTAATTTC 31
ORIfwBIO CAAGGATCCGGCTTTTAAGATCAACA ACCTGGAAAGGATCATTAAC TGTGAATGATCGGTG 5'-biotin labeled 32
ORIrv CACCGATCATTCACAGTTAATGATCC TTTCCAGGTTGTTGATCTTA AAAGCCGGATCCTTG 33
PE1 CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCxT Illumina oligo; x=Phosphorothioate linkage 34
SE1 CAAGCAGAAGACGGCATACGAGCTCTTCCGATCxT Illumina oligo; x=Phosphorothioate linkage 35
SEPE2 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCxT Illumina oligo; x=Phosphorothioate linkage 36
Personal tools