User:Spenser Skates/Notebook/pTKX luciferase biobrick/2008/04/16

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

Removal of XbaI site by site-directed mutagenesis

Performed site directed mutagenesis using the following primers for PCR in order to remove the XbaI site.

cattaatgaattgccgaataatctggattttgaaggccataaattg,luxMutPF
caatttatggccttcaaaatccagattattcggcaattcattaatg,luxMutPR

Changed base 2122 from A to G.

Used Phusion mix, applied the following protocol:
Knight:Site-directed_mutagenesis/Single_site

Personal tools