User:Sean P Corum/Notebook/PHIX174 Cell Free/2012/06/26

From OpenWetWare

Jump to: navigation, search
PHIX174 Cell Free Expression Main project page
Previous entry      Next entry


Characterization B: Expression of PHIX174 promoters fused to UTR1-deGFP.

  • Sequencing results are in. No good clones for pBEST-PA-UTR1-deGFP-T500.
  • I am going to abandon this strategy for cloning and go with direct creation of PHIX174 linker promoters to be ligated into pBEST-//-UTR1-deGFP-T500 backbone. The design file is here, and the oligonucleotide order is here. The were ordered a while ago,so I already have them in stock.
  • I performed hybridization to create linkers at 1mM concentration. Seven linkers were made this way: SphI-PX-NheI, where X = null, A, B, D, F, G, L.
  • I initiated construction of the eigth LA linker by PCR.
    • Sense primer = GTCGACGCATGCATGACTCGCAAGGTTAGTG, Antisense primer = GCTAGCGAATTCGGAGGCATGAAAACATACA, TH = 57 °C, 30 cycles.
    • Next steps will be purification, double digestion, and then gel extraction to get the final linker product.

Characterization C: Expression of PHIX174 promoters fused to UTRX-deGFP.

  • Continuing on in the construction of pBEST-PX-UTRX-deGFP-T500 (X = A, B, D, F, G, L, and LA), ligation products from yesterday were transformed into JM109 and grown O/N on LB+amp plates at 37 °C.

Hypothesis 2: Gene L is necessary for phage propagation.

  • Need to design new primers (regular and mutagenic) for amplifying PHIX174 genome.


Notes

Recent changes


Digital Signature

  • SC 18:36, 26 June 2012 (EDT):


Personal tools