User:Rain Elise Freeman/Notebook/Biology 210 at AU
NOTE: IF YOU WOULD LIKE TO OBSERVE MY ACTUAL NOTEBOOK (one that I could figure out and decided to use because it was more organized for me) PLEASE VISIT THE TUMBLR PAGE I CREATED:
www.rainslabnotebook.tumblr.com
4.8.15 This notebook could be improved. I had a look at your tumblr lab notebook which is good. SK
Zebrafish Recap & Final Observations and conclusions
Hypothesis: Fluoride exposure has adverse effects on zebrafish embryonic development, as determined by qualitative and quantitative analysis of fourteen days of development.
If we expose zebrafish embryos to 10mg/L of fluoride, then negative developmental effects will occur, such as smaller eye diameter and shorter tail length. Observations will be recorded on a random sample of three embryos with whether or not the observation category is applicable, approximate hourly development stage, regardless of actual age, measurement under the dissecting microscope, and qualitative observation. Zebrafish were approximately 6-7 days hours old when we exposed them to fluoride treatment and control conditions.
Here are from the observations from Day 0:
(view at rainslabnotebook.tumblr.com)
Day 4: (view at rainslabnotebook.tumblr.com)
Photo of control larvae:
(view at rainslabnotebook.tumblr.com)
Photos of treatment larvae: (view at rainslabnotebook.tumblr.com)
On Day 4, both groups seemed well past the depiction of the 48 hour stage of development in our lab manual. However, within the treatment group, some bodies seemed much more curved, as if they were in the 33 to 36 hours stage. Eye development is farther along within the control group, while eyes are smaller and lighter in color within the treatment group. The pectoral fin is also more developed within the control group, and it makes for an obvious setback for the organisms in the treatment group. It looks frailer, smaller, and it makes slow twitching movements as if it has a hard time propelling itself forward. The general movement of the treated individuals is much similar, versus the control individuals who move around quickly, constantly, and sporadically. Additionally, the control groups have slightly longer tail lengths and eye diameter than the treatment group.
We came back on Day 7 to find all of our zebrafish larvae dead and decently decayed.
Conclusion:
The control group is considerably healthier-looking than the treatment group. At this point, the control group has more living hatchlings, and they are moving around fast and their fins seem to be working properly. The treatment group has many more found dead, and those that are alive look like they will be dying any minute. For the one zebrafish larvae in this group that is moving, it is moving very, very slightly. While these fish were not incubated and already particularly old when we started treating them, we were still able to make obvious observations from what we can assume is the sodium fluoride causing adverse effects for the development of our zebrafish embryos.
In our predictions, we hypothesized that we would see shorter eye diameter and shorter tail lengths among the treatment group. While the data does show longer tail lengths and eye diameter for the control group, the differences were only slight, but that definitely does mean something. However, what was more remarkable was how much more curved and less developed the tails of the treatment group were overall. Whereas in the control group, the tails were completely straight and functioning very well. Though our model paper singled out eye diameter and tail length as features that would have great impacts, we saw the lack of development and effectiveness of the structures more greatly affected in our experiment. Eye diameter was barely different as well, but the eyes for the treatment group were abnormally lighter in color.
16S Genome Sequence
A few weeks ago, when we examined bacteria culture growth from our transect samples, we performed PCR and had our samples sequenced. While the PCR process for our group didn’t have too many problems, our samples were a little difficult to be identified. Nonetheless, we were able to recover bacteria sequences most likely related to ours.
View same entry with pictures at this link: [1]
Sample 1:
For our first sample, we received the sequence of Bacillus cereus.
Bacillus cereus has been recognized as an agent of food-borne illnesses for a few decades, now. It is also gram-positive and rod shaped. It’s motile, and some strains of it are actually beneficial to animals in the form of a probiotic.
Our observation of bacteria from our culture that related to this sample included the presence of motile, gram-positive, rod-shaped bacteria. Therefore, it is likely that the culture did contain Bacillus cereus.
http://textbookofbacteriology.net/B.cereus.html
Sequence for Bacillus cereus: NNNNNNNNGGNNGCNANANTGCAGTCGAGCGAATGGNNTGATANCTTGCTCTCNNAANTTAGCGGCGGACGGGTGATTAA TACNTGGGTAACCGGCCGNGGGACTGNCATAACTCCGGGAAACCTGGTATAATACCGGATAANATTTTGAACTGCNGGGT TCGAAATTGCTTGGCCGCTTCNGCTGTCCCTTATGGATGGACCCACNTCGCATTATCTAGTTGGTGANGTAACAGCTCAC CAANGTAACCATGCGTANCCGACCTGANANGGTGATCGGCCACACTGGGACTGANCCACGGNCCAGACTCCTAGGGGAAG CANCANTANGGAATCTTCCCCTGTGGACGAAAGTCTGACGGAGCAACGCCNCGTGTNTGATGAANGCTTTCTNGTCGTAA AACTCTGTTGTTATGGATNAACAAGTGCTAGTTTAATAAGCTGGCACCTTGNNANNACCTNCCCNNAAAGCCGCGGCTAA CTACGTGCTANCAGCCNTGGNAATANNTNTGTGGCAAACTGTATGCCGANTTNTCGCNCGTAANANGGCGTCCCCCGTTT CTTACCTCTGATGGGAACNNNNGGNGNATNTCTNGAGANGTGCANNGNAAAGGGTAANATGNGAGCNA
Sample 2:
The second sample yielded results that closely resembled Chryseobacterium. This is a genus of gram-negative, non-motile, and yellow-pigmented. Some species are found in raw milk in Israel, or other dairy products, and others include rare or uncommon pathogenic tendencies for newborns. Unfortunately, we did not get an exact species.
Our second petri dish sample did reflect a non-motile, gram-negative, and rod-shaped bacteria, so we can likely confirm this genus.
Chryseobacterium genus sequence:
NNNNNNNNNNNNNNNNNNNNNCAGCCGAGCGGTAGAGANTCTTCGGAATCTTGAGAGCGGCGTACGGGTGCGGAACACNT GTGCNACCTGCCTTTATCTGGGGGATAGCCTTTCGAAAGGAAGATTAATACCCCATAACATATTGATTGGCATCAATTGA TATTGAAAACTCCGGTGGATAGAGATGGGCACGCGCAAGATTAGATAGTTGGTGAGGTAACGGCTCACCAAGTCAATGAT CTTTAGGGGGCCTGAGAGGGTGATCCCCCACACTGGTACTGAGACACGGACCAGACTCCTACGGGAGGCAGCAGTGAGGA ATATTGGACAATGGGTGAGAGCCTGATCCAGCCATCCCGCGTGAAGGACGACGGCCCTATGGGTTGTAAACTTCTTTTGT ATAGGGATAAACCTTTCCACGTGTGGAAAGCTGAAGGTACTATACGAATAAGCACCGGCTAACTCCGTGCCAGCAGCCGC GGTAATACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTAGGCNGGGCTCGTAAGTCAGTGGTGA AATCTCATAGCTTAACTATGAAACTGCCATTGATACTGCGAGCCTTGAGTAAGGTAGAGGTAGCTGGGAATAAGTAGTGT ANCGGTGAAATGCATATATATTACTTANAACACCNATTGCGAAGGCAGGNTTACCNTGTCTTAACTGACGCTGATGGACG AAAGCGTGGNGGAGCGAACAGGNNTTAGATACTCCTGGGTAGTCCACGCNNTAAANGATGCTNNNTNCGTTTTTGGGTCT TCNGATTCNNANACTANNNNAAANTGATANNTNAGNCCACCTGGGGGAGTACNTTNNNNANCANTGAANATTNTNACNNN TNGACTGGGGGCCCGCCNCNANCGGNNGNATNANGTNGNTTANTNNNNNNTACGCTGGGNNCNTNNCATGNCTNNNNTGG GAGTNNNNAGNTNGNANNNGACTTTCNTCNNANANNTNTNNTGTNNCNNNCNNGGGNNGGNNNNNNNCNCNNNCCNNNNA NGNNTNGNTNNNNNNNNGCNNNNNNCNN
Zebrafish Experiment
Hypothesis: Fluoride exposure has adverse effects on zebrafish embryonic development, as determined by qualitative and quantitative analysis of fourteen days of development.
If we expose zebrafish embryos to 10mg/L of fluoride, then negative developmental effects will occur, such as smaller eye diameter and shorter tail length. Observations will be recorded on a random sample of three embryos with whether or not the observation category is applicable, approximate hourly development stage, regardless of actual age, measurement under the dissecting microscope, and qualitative observation. Zebrafish were approximately 24 + 4 days hours old when we exposed them to fluoride treatment and control conditions.
Day 1 Observation of control: I counted 19 alive embryos and 1 dead embryo which I removed.
Day 1 Observation of treatment: I counted 17 alive embryos, and one dead embryo (which Rain removed). We may have not had enough embryos in the first place, however my eyesight is bad and even worse when using a microscope so there's definitely a chance I miscounted and we will see again on Monday
Day 4: It was found that our experiment was contaminated and spilled over, and we had to restart with embryos from 2/18....10 eggs per treatment.
2.19.15 Missing some data on plant samples found in your transect. Could include data table from manual. SK
'''Plantae and Fungi - Lab 4'''
Purpose In the Plantae and Fungi lab, the procedures were meant to let us understand the characteristics and diversity of Plants, as well as to appreciate the function and importance of Fungi.
Materials and Methods For procedure one, we obtained two ziploc bags and took them with us to our transect. We obtained a samples of dead leaves, plant matter, and a small amount of the top layer of soil, and transferred the samples into the ziploc bags. This was roughly 500 grams of leaf litter. We also took representative samples from two plants in a minimally damaging way. These two plants were the only plants available, and appear to be ornamental cabbage and kale. Later on we set up a Berlese Funnel using these samples. A conical tube was used to place the neck of the funnel inside. Inside the tube was 25mL of 50% ethanol and 50% water. We secured the funnel and the tube together with masking tape, and then used a metal clamp attached to a stand under light to hold the funnel. The sample was then placed inside the funnel. We will return to it at the next lab.
For procedure two, we observed and characterized the vascularization in each of the plants from our transect. For procedure three, we observed the shape, size, and cluster arrangement of the leaves from the transect plants. We also, for both procedures, observed these characteristics in a lily plant and a tomato.
We also put bits of our bacterial PCR samples through gel electrophoresis to decide which ones to send off to the lab.
Data and Observations While we were dissecting the reproductive structure of the lily plant, we observed both the male and female organs present on the plant. The anther, which is male, produces haploid pollen sperms and the stigma, or the female part, is what the pollen attaches to. This results in a pollen tube which goes to the ovary were a zygote forms. We identified the lily as a monocot, based on it’s six petals being a multiple of three, and based on the leafs which show its vascularization as well. Below is the data observed from our transect samples as well.
For the most part, we couldn’t really observe specialized structures or mechanisms of reproduction. We were able to conclude that the lily was a monocot angiosperm. We can conclude possible good gas exchange for our kale plants as well. As for our gel electrophoresis process, we chose to send our 2nd and 3rd sample off based on the results.
Feb. 12, 2015 ... 12:48 AM EST
REF
'''Lab 2 - Algae and Protists'''
Procedure 1:
During procedure one, where the class was given prepared slides and a dichotomous key to identify protist organism, I had one of my first successful microscope attempts in a while. Usually I have a hard time locating organisms through the lens, or I have trouble focusing on the right level. However, this time it took me only a few seconds to find the organism. Using the dichotomous key was relatively easy as well and I was able to identify the organism as a Colpidium (Fig. 1). They belong to the Phylum Ciliophora. Their form of motility involves cilia and they're length can range from 50-70 micrometers. Figure 1
(http://www.microscope-microscope.org/applications/pond-critters/protozoans/ciliphora/colpidium.htm)
Procedure 2:
In this procedure, we examined samples from our Hay Infusion Culture. We were supposed to take two samples: one near growth toward plant material at the surface, and one toward the bottom or gel area. We were supposed to observe three different microorganisms from each sample. For the gel sample, after a while we seemed to be able to locate what looked liked spirosotomum (Fig. 2) which is a free-living ciliate, one or two organisms of Paramecium aurelius (Fig. 3), and a multitude of chlamydomonas (Fig. 4).
Figure 2
(http://en.wikipedia.org/wiki/Spirostomum)
Figure 3 (http://www.oocities.org/quetl/paramecium.htm)
Figure 4Inline image 1
(http://www.biology-resources.com/drawing-chalmy-01.html)
Procedure 3:
Next, we prepared and plated serial dilutions in order to prepare for the next week's microbiology lab. We were to let the bacteria grow over a week and examine the growth then. To do this, we inoculated nutrient agar petri dishes and placed our dilution of bacteria samples on plates with just agar, as well as plates with agar and tetracycline. Tetracycline is used to treat bacterial infections (http://www.nlm.nih.gov/medlineplus/druginfo/meds/a682098.html) and the point of using it in some of the agar plates was to see if any bacteria collected from our samples were resistant.
==
REF
'''Lab 1 - Biological Life at AU'''
Purpose The reason for this laboratory is to understand the evolutionary process of natural selection and how that process can drive the evolution of different species.Through our transect portion of the lab, we can observe the characteristics of different niches in our assigned ecosystem.
Materials and Methods For procedure one, we observed organisms Chlamydomonas, Gonium, and Volvox, underneath a microscope. We looked at the number of cells in sight at different magnifications, the colony size in micrometers, the specialization of cells, mechanisms of motility, and whether or not they were isogamous or oogamous. We also drew pictures of the observed specimen.
For procedure two, we observed at niche at AU. Our niche was transect 4 and located behind Leonard Hall. We used a sterile 50 mL conical tube to take a soil/ground vegetation sample that was representative of the transect. When we returned to lab, we placed ~11 grams of the soil/ground vegetation sample in the plastic jar with 500 mLs of deerpark water. We added 0.1 gm dried milk, and put lid on the jar and gently mix it for 10 seconds. We removed the top of the jar and placed the open jar on the table in the back of the lab. We also labeled the jar and lid with our group initials and transect number.
Data and Observations File:ScreenshotAA.jpg
Conclusions and Future Directions The volvocine line may have started as isogamous and progressed too oogamy down the line. We will continue to take samples from our transect and perform observations and experiments throughout the class.
Started writing around January 17-20th, but didn’t publish until February 12th at 12:31 AM
REF
==
