User:Pedro Matos/Notebook/Aulas Biologia Molecular 2010/2010/04/27

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

TP6

Exercício 1 – Extremidades e ligações

Considere as seguintes enzimas e respectivas sequências de restrição ( o traço indica a ligação fosfodiéster que é clivada):

Bam HI : G|GATCC Hae II: GG|CC Eco RI: G|AATTC Bgl II: A|GATCT

  • 1. Que característica invulgar tem a sequência de reconhecimento destas enzimas?

São palindrómicas, ou seja, a sequência complementar ao ler no sentido 3'-5' são iguais.

  • 2. Represente as extremidades 5’ e 3’ de moléculas de DNA cortadas com cada uma destas enzimas.
Bam HI :---G      GATCC---
        ---CCTAG  G-------
Hae II: ---GG     CC------ 
        ---CC     GG------
Eco RI: -G        AATTC--- 
        -CTTAA    G-------
Bgl II: -A        GATCT---                                    
        -TCTAG    A-------
  • 3. É possível ligar uma molécula de DNA com extremidades cortadas por Bam HI a outra com extremidades cortadas por:
BamHI? Sim
EcoRI? Não
BglII? Sim
  • 4. Em média, os fragmentos resultantes da digestão de DNA genómico humano com Bam HI serão maiores ou menores que os fragmentos resultantes de digestão com Hae II? Justifique.

Maiores, uma vez que a a sequência que Hae II reconhece é menor que a do Bam HI. Assim a probabilidade de um GGCC ocorrer no genoma maior que um GGATCC, logo a enzima actua mais vezes fazendo fragmentos menores.

Exercício 2 – Mapas de restrição

As enzimas de restrição podem ser usadas para criar um mapa físico de uma molécula de DNA, reflectindo a sequência subjacente. Para isso, o fragmento de DNA a caracterizar é digerido com duas ou mais enzimas de restrição e analisado por electroforese em gel de agarose.

  1. A que correspondem as bandas azuis no gel?

As bandas azuis no gel correspondem a corantes de electroforese, o azul mais escuro permite ver a colocação da amostra nos poços e seguir o desenvolvimento da electroforese.

  1. Considere a digestão do DNA plasmídeo pBR322 com PleI e BglI. Quantos fragmentos de DNA espera, e quantos consegue observar? Porquê?


             PleI    BglI
Esperados: |  4    |   3  |
Observados:|  3    |   3  |
Isto ocorre pois a resolução da electroforese não permite separar fragmentos que difiram por poucos pares de bases.
  1. Que papel tem a concentração de agarose na análise de fragmentos de restrição?

A concentração de agarose está relacionada com o tamanho da malha do gel de agarose, logo géis mais concentradas implicam uma malha mais apertada levando a uma separação mais eficiente de fragmentos com menor variabilidade no número de base

  1. Se pretendesse determinar de forma rigorosa o tamanho dos fragmentos de DNA observados na electroforese, como poderia fazê-lo?

Usando o marcador de pesos moleculares, faria uma recta de calibração em que poria o logaritmo do peso molecular dos fragmentos em função do tempo de retenção e depois com o tempo de retenção dos fragmentos digeridos conseguiria estimar o ser peso molecular.


Os produtos de digestão do genoma do bacteriófago lambda (de 48510 pares de bases) são muito utilizados como marcadores de tamanhos moleculares em electroforeses de DNA. A enzima EcoRI corta o genoma do fago em 5 locais: 21227, 26106, 31749, 39175, 44980. Considere o resultado de uma electroforese apresentado em cima.

  1. Poderá corresponder a uma digestão do DNA lambda com a enzima EcoRI ou não? Porquê?

Sim, pois a enzima ao cortar o bacteriófago λ em 5 locais formaria 6 fragmenotos, visiveis na electroforese.

  1. Considerando que a quantidade total de DNA presente neste gel é de um micrograma, relativamente a cada uma das bandas observadas:
    1. Quantas moléculas de DNA estão na primeira e na última banda observadas no gel?
    1. Que quantidade de DNA está nas mesmas bandas?

Bacteriófago λ DNA= 31.6*105

Considere um segmento de DNA de 10000 pares de bases (bps) e os fragmentos formados após digestão com as enzimas EcoRI e HindIII:

  1. DNA x EcoRI = 5000 + 3000 + 2000
  2. DNA x HindIII = 5500 + 4500
  3. DNA x EcoRI x HindIII = 5000 + 3000 + 1500 + 500
    1. Com base nesta informação, construa o mapa de restrição desta molécula.


Utilize o Webcutter ou o NEBcutter para gerar um mapa de restrição da sequência do cDNA da beta-globina e indique:

  1. uma enzima de corte único;
  2. uma enzima com dois cortes;
  3. uma enzima que não corta neste DNA.

(ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AG|GCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT CCTGAGAACTTCAG|GCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAAAA AAAAAAAAA)

Personal tools