User:Patrick Wu

From OpenWetWare

Jump to: navigation, search

Contents

Contact Info

Patrick Wu (an artistic interpretation)
Patrick Wu (an artistic interpretation)
  • Patrick Wu
  • MIT
  • Next House
  • Email: p_wu [at] mit.edu

Registration/Questionnaire: 20.109 Fall 2008

Last Name

Wu

First Name

Patrick

Preferred name

Patrick

Course/Minor

20, maybe also 18, minor in 15

Year of Graduation

2011

Email

p_wu AT mit DOT edu

Have you taken or are you taking...

7.05/5.07 (Biochemistry) - no
7.06 (Cell Biology) - no
7.02 (General Biology Lab) - no
5.310 (General Chemistry Lab) - no

Do you have any experience culturing cells (mammalian, yeast or microbial)? - No

Do you have any experience in molecular biology (electrophoresis, PCR, etc)? - No (actually, minimal)

Please briefly describe any previous laboratory experience

Worked in a labbish enviroment over the summer (not very formal, not a research lab)

Anything else you would like us to know?

nope

Education

  • 2011, BS in Biological Engineering, MIT

Module 2 Information

Designing forward and reverse primers to tag specific YGR067C protein at the 3’ end of DNA sequence

TCCATGGAAAAGAGAAGATG - Tm 49.6 deg C

Forward Primer 5’CAAGAATTCTCAGCTTCTTCAACTGACAATAAACAAAGTTCCATGGAAAAGAGAAGATG3’ G/C content 33.9%, Tm 64.7 deg C

TACGACTCACTATAGGGCGA – Tm 54.3 deg C

Reverse Primer 5’CTTTGGCCATTATTTTATTTGGCTAAAAATTTCAATGTTTACGACTCACTATAGGGCGA3’ G/C content 33.9%, Tm 65.4 deg C

Sequence of YGR067C

5’ ATGGCTGCGGGTCAAAAAAAATATATATGTTCCTTTTGTTTGAAGCCTTTCTCGAGATCC GAGCACAAGATAAGGCATGAAAGGTCTCATGCGGGCGTGAAGCCTTTCCAGTGCCAAGTC TGTAAACACTCTTTTGTTAGACGCGATCTCTTACAGCGACACATCAGGACTGTCCACAGA ACCTTCCTCTTATCCAGTTACGCGTCAATGACAGGCGATAAGGCTGATATCCCTGTATCA CTTGGCGTTGGTGACGTTGATTCGACTTCACCCAGAGATATCAAAATGGAAACACTCGTT AATTCGATGATTAAGGTCAACAGCGGCCTTATCAATATTCACTATCATAGTAGTAATGTT GAAAAAATGGATAAGCAGCAACGTTGTGTGATTGGGAAGGAGTCCTCTAGTTTAAAGAAA GGGAAAAGCCGCTTTAAGCAGGTTAAAAGCCGGTTGGAGTCCTCCATCAGTGTAAAAATT TTGCAAGAATATTCATTAGATTTTATTAGCTCAAGAGATATTCTAACTTTCTTCAGAATG GGTGTAAGCCACTTGGTAGAAAATAAGATCTTCCAAAATTTCTTTCCAGACCTGTTCTCA TCACTACAAAATGACGAGCTGGTGGAAAGTTTTTGGATTAACAAGCCTTTTGGTCTCATA ATAGCTTGTCTGGGTATGTCCATTTCGTTAAATCAAGATTCTCAAAAACTATGGTTTATC TGTTGTACGAATTTGTATGCTAGCTCATCTAAACATGACAATGACTTTGACACTGAGGAC ATTTTGTCACAGACAGAGCAACATGATGTTTTTGCCTTGATTCTATTTTATTCTCTTCTA GTAATGTTGGAGAATAACATTCCTGTTTCTAATTCCATTAAAAAGTTCGATGTGTTTTCA ATGCTTCAAGATATTCTGAAGCCATTCACCGTGGCATCCTCCAGTTACCATTATTTGAAT AGTAAGGAAAATGCATGGTTCATATTCGATCTATGGGTCAATATCTTGCGCGATTCAAAC AACTTCAACAACGATTCTTTACTAATATTTGGTTGGTTCGTCAATCAAGAGTTTATTTCG TCTAATCCACTTAAGGACTTCATATACAAGGGACCGTCAATGTCCACTACTGACTTAACT TTAAAGCATATCAATATTTTGGCAGATTCCGCGTACGTGTATTTTATAATAAAGAAGACT TATCCGCAAGAGCTGCCATCTGATTTTAGAGTGCATGATTTGCTGGTTTACTTGAATGAA TGTTTCGTAATGCAGCAGCCGATCAAACCTGAAACTAGTGCAAACCCCTCTTTATTTGCG AACGTTATGAACGCCAGGATTACGGACTGCAAATCGAAAAGTAACTGGTTATTGTGGGAA ACGATTTGGTTCGAATTCATCAACAACTTGACTTTGAGAAATGGGACCACAAGGAACATA TGGTTCATTGATAACTTTCCACAGGTATCGACCTCGTGCTTACTTCATCATTCTTCCTCA TTTGTTGATGAAACCTTGATCACCACGAACTTATCAATCATATCAATGCTTCTTAATTTG AAGTCTTTCACGCTGGCATCTTTAAACCCAAGGAATATTCAGTTAATTACCGACATTGTC AGCTTCCAACTAAAATTGTTTTCATCGGAGTTAATTGCAAGCTCGGATGTTTCACCATCA CAAGTATCTCAATTACTAGTAAACCCCAATGTTCACCTAATGTTATATTTCTGGTTCGAT ACCATTTATGTACAACGTCAGAGCTACCTTTCATCAACAGAGAAAGAGGAATTTGAGAAG GTTGAAGTGTTTGTGAATGACTACATTATAACACACCAAAAGAACTTGGTGACAGACTTA CACTCCATTTTGTTCGATTTTTGGTCAGATTCCTTCATTGCTTACCATATACTACTGCAT GCTATTGTATCTTCATTAAGAGATAATATTCTTTACCCATACTTAATCTACTCCCCTCAC CTGAATGACCAGACGAAAGCATTGTTGACTGATATCTCTAATTGGTCTTGTTTTGCTCTT CAACAGCCGTTTCGCAAGACTTCAAGAGGTTCTTTATCTGGTGCTTCTGATATGAAATCG TTTTCAGTAGCATCATGTTTGCCACTCTCTCCTAATTTCCTAAAGAGAGATTCAAACTGT AATAAGATTCTCCTGCCCCCATTAGATATAAAAGCCATTGAACCTATCTCAACGAGTAAT TACACCTACGTGAACTCGGCCCCTAAGCAACAAGAGAAGGAACAACCATTGTTAAGGGCA ACAGGAAACAATATCAATTTAGTCCAAACAATAGTGGTCCCACCCCAGGTAAACATGGAA TCACAAGAATTCTCAGCTTCTTCAACTGACAATAAACAAAGTTAA 3’

base pairs following gene… 5’AACATTGAAATTTTTAGCCAAATAAAATAATGGCCAAAG3’

Module 3 Link

Click here for more info.

Publications

Useful links

Personal tools