User:PJ Steiner/Notebook/synthesis/2009/06/03

From OpenWetWare

Jump to: navigation, search
synthesis Main project page

Synthesizing a RFP for M. florum.

Here's the sequence:

 >MF-RED2
 GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTCACACAGGAAAGACTAGATGGCTAGTAGTGAGGATATAATCAAAGAGTT
 TATGCGTTTTAAAGTTCACATGGAAGGTTCAGTAAACGGACATGAATTTGAAATTGAGGGAGAAGGAGAGGGTCGTCCGT
 ACGAAGGTACACAAACAGCAAAGTTAAAAGTAACAAAAGGAGGACCTTTACCATTTGCATGGGATATTCTTTCTCCACAA
 TTTATGTATGGTAGTAAAGCGTATGTTAAACACCCGGCAGATATACCAGACTATTTAAAGTTGAGTTTTCCGGAAGGATT
 CAAATGGGAACGTGTTATGAATTTTGAAGATGGTGGTGTTGTTACAGTTACTCAAGATAGTAGCTTACAGGATGGTGAAT
 TTATTTACAAAGTAAAATTACGTGGTACTAACTTCCCGAGCGATGGTCCAGTAATGCAAAAGAAAACTATGGGATGGGAG
 GCTAGTTCTGAACGTATGTATCCTGAAGACGGTGCTTTAAAAGGAGAAATTAAACAACGTTTGAAACTTAAAGATGGTGG
 ACACTACGATGCAGAAGTTAAAACTACATATAAAGCTAAAAAGCCTGTTCAGCTTCCGGGTGCTTATAATGTGAATATAA
 AATTAGATATCACAAGTCATAACGAAGATTATACTATTGTTGAACAGTATGAAAGAGCAGAAGGAAGACATTCTACAGGA
 GCATAATAATACTAGTAGCGGCCGCTGCAGGTGGATAC

This is a bit changed from the one TK sent originally (to remove inverted repeats at the end).

Ran a version of bl with the following parameters:

 (length-min 40)
 (length-max 60)
 (overlap-min 10)
 (overlap-max 20)
 (repeat-min 8)
 (buf-size 1)
 (min-hairpin-stem 6)
 (min-hairpin-loop 3)
 (target-tm 45.0)
 (max-tm-dev 2.5)
 (primer-conc 0.00001)
 (salt-conc 0.01)

The oligos it gave:

 > 0-43-f
 GTTTCTTCGAATTCGCGGCCGCTTCTAGAGTCACACAGGAAAG
 
 > 27-70-r
 TTATATCCTCACTACTAGCCATCTAGTCTTTCCTGTGTGACTC
 
 > 50-99-f
 GGCTAGTAGTGAGGATATAATCAAAGAGTTTATGCGTTTTAAAGTTCAC
 
 > 79-132-r
 TTCAAATTCATGTCCGTTTACTGAACCTTCCATGTGAACTTTAAAACGCATAA
 
 > 114-154-f
 AACGGACATGAATTTGAAATTGAGGGAGAAGGAGAGGGTC
 
 > 139-179-r
 GCTGTTTGTGTACCTTCGTACGGACGACCCTCTCCTTCTC
 
 > 163-208-f
 AAGGTACACAAACAGCAAAGTTAAAAGTAACAAAAGGAGGACCTT
 
 > 192-252-r
 ACCATACATAAATTGTGGAGAAAGAATATCCCATGCAAATGGTAAAGGTCCTCCTTTTGT
 
 > 232-272-f
 CTCCACAATTTATGTATGGTAGTAAAGCGTATGTTAAACA
 
 > 252-292-r
 AGTCTGGTATATCTGCCGGGTGTTTAACATACGCTTTACT
 
 > 275-335-f
 GGCAGATATACCAGACTATTTAAAGTTGAGTTTTCCGGAAGGATTCAAATGGGAACGTGT
 
 > 320-377-r
 TCTTGAGTAACTGTAACAACACCACCATCTTCAAAATTCATAACACGTTCCCATTTG
 
 > 357-402-f
 GTTGTTACAGTTACTCAAGATAGTAGCTTACAGGATGGTGAATTT
 
 > 383-439-r
 TCGGGAAGTTAGTACCACGTAATTTTACTTTGTAAATAAATTCACCATCCTGTAAG
 
 > 423-481-f
 GGTACTAACTTCCCGAGCGATGGTCCAGTAATGCAAAAGAAAACTATGGGATGGGAGG
 
 > 466-506-r
 TCAGGATACATACGTTCAGAACTAGCCTCCCATCCCATAG
 
 > 488-528-f
 TGAACGTATGTATCCTGAAGACGGTGCTTTAAAAGGAGAA
 
 > 510-562-r
 GTCCACCATCTTTAAGTTTCAAACGTTGTTTAATTTCTCCTTTTAAAGCACC
 
 > 543-589-f
 AAACTTAAAGATGGTGGACACTACGATGCAGAAGTTAAAACTACAT
 
 > 569-620-r
 CCCGGAAGCTGAACAGGCTTTTTAGCTTTATATGTAGTTTTAACTTCTGCA
 
 > 608-667-f
 TCAGCTTCCGGGTGCTTATAATGTGAATATAAAATTAGATATCACAAGTCATAACGAAG
 
 > 649-699-r
 TGCTCTTTCATACTGTTCAACAATAGTATAATCTTCGTTATGACTTGTGA
 
 > 681-725-f
 GAACAGTATGAAAGAGCAGAAGGAAGACATTCTACAGGAGCATA
 
 > 707-758-r
 GTATCCACCTGCAGCGGCCGCTACTAGTATTATTATGCTCCTGTAGAATGT

Ordered those on 6/2/2009.




Personal tools