User:Michaela Harper/Notebook/Biological Chemistry Lab/2011/10/12

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry


Objective

To compare the results of our mutated DNA sequencing to the original to see if the results were successful and to finish creating a four point probe (the epoxy did not dry overnight).

Description

  1. Compare the results of the DNA sequencing to the original sequence of GFP DNA used.
  2. Reapply epoxy to palladium foil and wires by placing the foil upside down with the wire on top. Apply additional epoxy and use a heat gun to dry until epoxy turns light grey. Then use crazy glue to apply leads to the teflon.
  3. Using fibers produced from a previous experiment, remove as much water as possible. Extract fibers in solution and apply them over all four leads. Allow the water to evaporate overnight.

Data

The following is the results of the DNA sequencing:

NNNNNNNNNNNTTTGTTNNACTTTAAGAAGGAGNTATACATATGCGGGGTTCTCATCATCATCATCAT CATGGTATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGGGATCTGTACGACGATGACGATAAG | GAT CGATGGGGATCCGAATTCGCCACCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCC TGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCAC CTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGA CCACCTTGACCTACGGCGTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAG TCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCG CGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG ACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAAGGTCTATATCACCGCCGACAAG CAGAAGAACGGCATCAAGGTGAACTTCAAGACCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGA CCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCC AGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCC GGGATCACTCTCGGCATGGACGAGCTGTACAAGTAACTCGAGAAGCTTGATCCGGCTGCTAACAAAGCC CGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGANCAATAACTAGCATAACCCCTTGGGGCCTCTAAACG GGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACT

Unfortunately, the sequence is the same as the original sequence and therefore, the mutation was unsuccessful.


The following is a picture of the 4 point probe with the fibers in solution laid across:

Notes


Personal tools