User:Mbennie/Notebook/Sequencing/8.7.2007

From OpenWetWare

Jump to: navigation, search

Template: 8ul DNA, 1.7ul water, .3ul primer

  • Fos3 with VF2
    • Completely correct
NNNNNNNNNNNACCTATANAATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGATG
ATTTCTGGAATTCGCGGCCGCTTCTAGAGGTACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTCTG
CTTTGCAGACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTAGAGTTCATCCTGGCAGCTCACCGAGGTACTAGT
AGCGGCCGCTGCAGTCCGGCAAAANAGGGCAAGGTGTCACCACCCCGCCCTTTTTCTTNAAAACCGAAAAGATTACTTCG
CGTTANGCNGGTTTCNTCGCTCNCTGAATCGCTNC
  • JunB2 with VF2
    • Completely correct
NNNNNNNNNNNNNNNCTATNNNNTAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGA
TGATTTCTGGAATTCGCGGCCGCTTCTAGAGGTATCGCGCGCCTGGAGGACAAGGTGAAGACGCTCAAGGCCGAGAACGC
GGGGCTGTCGAGTACCGCCGGCCTCCTCCGGGAGCAGGTGGCCCAGCTCAAACAGAAGGTCATGACCCACGGTACTAGTA
GCGGCCGCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGC
GTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGC
GGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACC
GTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAG
AGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGAC
CCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTANGTATC
TCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCC
GGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAG
AGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTA
TCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAANGAGTTGGTAGCTNNNNTCCGGCAANAACCACCGCTGGTAGCGNG
GTTTTTTTGTTGCAGCAGCANATACNCGCANAAANNNTCTCANANNATCNTTGATNTTTCNANGGNCTGACNNTCNNNNN
NAAACNNNNNNTNNNNNTNNNNTNNANTNNNTCNNAAGNANNTNNCNNNATCNTTNANNNNNNGNNNNANNANNNGNNNN
TGATANNTGNNTNNNNGNNTNNNNNNNNNNNNNN
Personal tools