User:Mbennie/Notebook/Oligos/Mut Pst1b-F

From OpenWetWare

Jump to: navigation, search

Sequence: gctcttcagccgcttactttgccaattatggcaa

Binding site: 23 bp

Predicted Tm: 55.2C

Received: 7/31/2007

  • Resuspended at 50uM with 502ul of TE
Personal tools