User:Mbennie/Notebook/Oligos/JunB-R

From OpenWetWare

Jump to: navigation, search

Sequence: gtttcttcctgcagcggccgctactagtaccgtgggtcatgaccttctgtttga

Binding site: 23 bp

Predicted Tm: 55.3C

Received: 8/1/2007

  • Resuspended at 50uM with 550ul of TE
Personal tools